BIOL 111 Lecture Notes - Lecture 24: Ribosomal Rna, Golgi Apparatus, Start Codon
Document Summary
Get access
Related Documents
Related Questions
Question 4
Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)
Guanine histone Double helix Adenine conservative cytosine | Okazaki fragments Thymine introns Leading strand RNA polymerase 5-prime to 3-prime | Uracil chromatin DNA ligase Semi-conservative promoter | Lagging strand DNA polymerase nucleosomes Electron transport chain enhancer |
Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.
Question 5
In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."
Lactose | Glucose | Lac expression? |
No | Yes | |
Yes | Yes | |
Yes | No |
Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.
Question 6
Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)
a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:
5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â
b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.
c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?
Which of the following did Erwin Chargaff observe?
| ||
| ||
| ||
| ||
|
The melting temperature (Tm) of a DNA duplex is:
| ||
| ||
| ||
| ||
|
Given your knowledge and the descriptions of each of thesemethods, which of the following does NOT rely on the ability ofnucleic acids to hybridize with each other?
| ||
| ||
| ||
| ||
|
Which of the following is a possible reason why DNA uses thymineinstead of uracil?
| ||
| ||
| ||
|
Which of the following is an enzyme used in cloning to breakcovalent bonds?
| ||
| ||
| ||
| ||
|
Which of the following could you use to remove the 5' phosphatesafter cleavage of a plasmid with a single type of restrictionenzyme to ensure that the plasmid would not simply fuse backtogether upon addition of ligase?
| ||
| ||
| ||
| ||
|
Which of the following would you use to create a cDNA librarythat you would not use for a genomic library?
| ||
| ||
| ||
| ||
|
A plasmid vector typically has which of the followingfeatures?
| ||
| ||
| ||
| ||
|
Which of the following is FALSE of genomic or cDNAlibraries?
| ||
| ||
| ||
| ||
|
Which of the following is NOT a typical component of apolymerase chain reaction (PCR)?
| ||
| ||
| ||
| ||
|
How can a fusion protein be formed?
| ||
| ||
| ||
| ||
|
Why is green fluorescent protein (GFP) so useful in visualizingfusion proteins in eukaryotes?
| ||
| ||
| ||
| ||
|
You wish to determine the cellular location of a protein butunfortunately it is not particularly antigenic (can t develop astrong antibody response). How could you solve this problem?
| ||
| ||
| ||
| ||
| ||
|
A positive result for the yeast two-hybrid analysis means thefollowing:
| ||
| ||
| ||
| ||
|
Which of the following is the approximate size of the humangenome?
| ||
| ||
| ||
| ||
|
Which of the following is correct about the structure orlocation of genes?
Question 22 options:
| ||
| ||
| ||
| ||
|