BSC 2010C Lecture Notes - Lecture 16: Okazaki Fragments, Dna Mismatch Repair, Dna Ligase

19 views6 pages

fuchsiayellowjacket831

16 May 2016

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Describe the data that led watson and crick to suggest their model of. Show how the double helix model of dna conformed to prior observations of the chemistry of the molecule and, at the same time, suggested mechanisms for the roles of dna in gene expression and chromosome replication. Define and explain the terms replication, transcription and translation. Define what is meant by semi-conservative dna replication and describe the role of okazaki fragments. Use the base-pairing rules to determine the nucleic acid sequences of new. Dna strands, mrna and trna from dna sequences. Trace the steps of protein synthesis, including the locations of the processes, the involvement of complex molecular machinery and the requirement for inputs of energy. Explain why the dna code must involve a reading frame of three bases. Introduction (cid:0) many basics of molecular biology determined using viruses that infect bacteria. Viruses composed of protein coat and internal genetic material (dna or.

Related Questions

1. _________________________ is the name of the process that produces proteins using RNA molecules.

a.Transcription

b Translation

c. Replication

d. Mutagenesis

2. The peptide bonding site on the ribosome:

a. A site

b. P site

c. E site

d. D site

3. The name given to the bond formed between two amino acids.

a. Hydrogen bond

b. Double bond

c. Peptide bond

d. Negative bond

4. __________________________ is the movement of the mRNA molecule on the ribosome to open up the A-site for the new incoming amino acid.

a. Transformation

b. Mutation

c. Translocation

d. Initiation

5. What does the term semi-conservative mean.

a. Replication of RNA is semi-conservative, each new strand consists of one old strand of RNA and one new strand of RNA.

b. Replication of DNA is semi-conservative, each new strand consists of one old strand of DNA and one new strand of DNA.

c. Replication of DNA is semi-conservative, each new strand consists of new strands of nucleotides.

d. Transcription of RNA is semi conservative.

6. This molecule functions during protein synthesis to recognize the codon and bring the proper amino acid back to the ribosome for translation.

a. mRNA

b. tRNA

c. rRNA

d. DNA polymerase

7. What is meant by the base-pairing rule.

a. Bases on a single strand of DNA are always found as pairs

b. Adenine always base pairs with guanine; cytosine with thymine

c. Adenine always base pairs with thymine; cytosine with guanine

d. Bases on a single strand of RNA are found in pair.

8. In this step of protein synthesis, amino acids are added to a growing polypeptide chain.

a. Initiation.

b. Elongation.

c. Termination.

d. Transpiration.

9. Three complementary bases found in a mRNA are called ____________________.

a. Anti-codon.

b. Triplet.

c. Doublet.

d. Codons.

10. Which statement best describes the job or function of the messenger RNA.

a. Carries the map of the gene sequence in the form of codons to the cytoplasm

for translation of the protein.

b. It transfers amino acids to the ribosome for protein synthesis.

c. It forms the ribosomes.

d. It helps replicate DNA.

ceruleangnat663

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BSC 2010C Lecture Notes - Lecture 16: Okazaki Fragments, Dna Mismatch Repair, Dna Ligase

Document Summary

Get access

Related Documents

BSC 2010C Chapter Notes - Chapter 16: Dna Polymerase Iii Holoenzyme, Dna Polymerase I, Maurice Wilkins

BSC 2010C Chapter Notes - Chapter 16&17: Transfer Rna

BIOL 1115 Study Guide - Midterm Guide: Okazaki Fragments, Dna Replication, Dna Polymerase

Related Questions