MCB 2400 Lecture Notes - Lecture 6: Single-Nucleotide Polymorphism, Tandem Repeat, Stem-Loop
14 Dec 2016
School
Department
Course
Professor
Document Summary
Where do genetic diseases come from: mutation in germline cell, mutation early on after fertilization. Human genome project goal: obtain a complete catalog of our genes: completed in 2003, variability in human genotypes exists in the form of: Cnvs (copy number variants): inversions, duplications, deletions & translocations. Vntrs (variable number tandem repeats) (10-100bp sequence repeated in tandem) While the repeated units themselves are usually the same between individuals the number of times they are repeated varies. Strs (short tandem repeats) (2-9bp sequence repeated, 1,000s known) Each variant acts as an inherited allele. Can be passed to offspring: far fewer genes than once believed, over 99. 7% same between 2 people. Strs (short tandem repeats: very short dna sequences (di-, tri-, tetra-, penta-) repeated in tandem in the genome, atgcacacacacacacaggcatcc, tacgtgtgtgtgtgtgtccgtacc. Dinucleotide sequence: differences between persons occur in the numbers of repeats, type of length polymorphism. Vary in number of times repeating unit appears in genome.
