BISC207 Lecture 3: UNIT 3 LECTURE NOTES

21 views8 pages

cerisefish601

14 Feb 2017

School

University of Delaware

Department

Biological Sciences

Course

BISC207

Professor

Boggs, Mary E.

For unlimited access to Class Notes, a Class+ subscription is required.

BISC207 Full Course Notes

Verified Note

25 documents

Document Summary

A modification in a cell"s information archive. Point mutations-- results from one or a small number of base changes. An organism"s genotype is determined by the sequence of bases in its dna. An organism"s phenotype is the product of the proteins it produces. Alleles of the same gene differ in their dna sequence. Proteins produced by different alleles of the same gene frequently differ in their amino acid sequence. Knowing the genetic code and the central dogma, biologists can. Predict the codon and amino acid sequence encoded by the particular dna sequence. Approximate the mrna and dna sequence that would code for a particular sequence of amino acids. Because of redundancy, more than one dna sequence could code for the same amino acid sequence. A mutation is any permanent change in an organism"s dna. Missense mutations-- change in an amino acid in the protein (substitution) Silent mutations-- do not change the amino acid sequence due to redundancy in the code.

Related Questions

Which of the following is NOT a direct consequence of the fact that DNA polymerase can only build onto the end of an existing nucleic acid?

Question 6 options:

	DNA replication requires primers
	Bits of DNA are lost from the ends of your chromosomes in each successive round of replication
	RNA is involved in DNA replication
	The enzyme "primase" is needed for DNA replication
	There are multiple origins of replication on each eukaryotic chromosome

How does a nucleotide sequence code for a protein in nearly all living organisms?

Question 7 options:

	a sequence of 3 nucleotides can code for one of 64 different amino acids
	a sequence of 2 nucleotides can code for one of 64 different amino acids
	a sequence of 2 nucleotides can code for one of 20 different amino acids
	a sequence of 3 nucleotides can code for one of 20 different amino acids
	a sequence of 3 nucleotides can code for 3 different amino acids

Fill in the blanks. To make one strand of DNA, _________ monomers are linked together in a chain, forming a polymer we call a(n) ________ .

Question 8 options:

	nitrogenous bases, hydrogen bond
	nucleotide, nucleic acid
	amino acid, nucleic acid
	nucleotide, nitrogenous base
	amino acid, protein

Which of the following was NOT part of the ideas that Darwin used in his book On the Origin of Species?

Question 9 options:

	organisms vary in characteristics that affect survival and reproduction
	variation in traits is often heritable
	descent with modification explains life's unity and life's diversity
	organisms inherit characteristics from their parents that the parents acquired in their own lifetimes
	natural selection is a cause of adaptive evolution

Here is a hypothetical mRNA sequence:

5' G G A U G C U A G U A U G A 3'

What is the amino acid sequence encoded by this mRNA?

Question 10 options:

	Met-Ile-Val
	Asp-Ala-Ser-Met
	Met-Leu-Val
	Ser-Met-Ile-Val
	Gly-Cys

Which statement is not correct?

Mutations change the sequence of nucleotides in DNA.

Mutations can be caused by mistakes made during the copying ofDNA.

Mutations can be caused by toxic chemicals in theenvironment.

Mutations are not random.

Mutations can change the function of proteins.

Mutations are the basis for all of the genetic diversity thatexists.

Which statement is not correct?

Chromosomes contain genes.

Chromosomes are made of DNA wrapped around protein.

Eukaryotes have many, linear chromosomes in their cells.

Different species can have a different number ofchromosomes.

DNA is made by putting a string of amino acids together.

Which statement is not correct?

Cells with homologous chromosomes are diploid

Cells with homologous chromosomes are haploid

Gametes are haploid

Diploid cells have two sets of chromosomes in theirnucleus.

Which is not a good example of alleles?

Brown hair and red hair, for the hair gene.

Stripes and no stripes, for a striped gene.

Ear lobe gene and freckles gene.

Straight nose and pug nose, for a nose gene.

indigowildebeest594

A biochemist was studying the structure of a normal (native) and mutant form of a globular protein. Both proteins could be crystallized, but the mutant protein had a different tertiary structure than the native protein.

1. The biochemist determined that an important structural region of the native protein was encoded for by the following mRNA sequence:

(5â) GCCAAAAGUACAGCAUGGCAA (3â)

Using the table of the genetic code (lecture 12, slide 10), list from the N-terminus to C-terminus the corresponding amino acid sequence for the native protein:

The same region of the mutated protein was encoded by the following mRNA sequence:

(5â) GCCAACAGUACAGCAGGGCAA (3â)

List from the N-terminus to C-terminus the corresponding amino acid sequence for the mutant protein:

2. Propose a plausible explanation for why the mutations led to a change in the tertiary structure of the native protein.

emeraldwalrus12

BISC207 Lecture 3: UNIT 3 LECTURE NOTES

BISC207 Full Course Notes

Document Summary

Get access

Related Documents

BISC207 Chapter Notes - Chapter 12-14: Deoxyribose, Recombinant Dna, Dna Replication

BISC207 Lecture Notes - Lecture 13: Francis Crick, Messenger Rna, Start Codon

BISC207 Lecture Notes - Lecture 14: Frameshift Mutation, Molecular Machine, Transfer Rna

Related Questions