Log in
Biology
1
answer
0
watching
72
views

A biochemist was studying the structure of a normal (native) and mutant form of a globular protein. Both proteins could be crystallized, but the mutant protein had a different tertiary structure than the native protein.

1. The biochemist determined that an important structural region of the native protein was encoded for by the following mRNA sequence:

(5’) GCCAAAAGUACAGCAUGGCAA (3’)

Using the table of the genetic code (lecture 12, slide 10), list from the N-terminus to C-terminus the corresponding amino acid sequence for the native protein:

The same region of the mutated protein was encoded by the following mRNA sequence:

(5’) GCCAACAGUACAGCAGGGCAA (3’)

List from the N-terminus to C-terminus the corresponding amino acid sequence for the mutant protein:

2. Propose a plausible explanation for why the mutations led to a change in the tertiary structure of the native protein.

Watch
1
answer
0
watching
72
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Jamar Ferry
Jamar FerryLv2
28 Sep 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

The trp-cage protein is a tiny protein with a 20 amino acid sequence. The sequence (starting from the N terminus) is NLYIQWLKDGGPSSGRPPPS

a. Using the sequence, write the mRNA code corresponding to trp-cage. Write it in the 5’-3’ direction.

b. Write the DNA sequence corresponding to the trp-cage. Specify the 5’-3’ direction.

c. Explain the steps from transcription to translation to generate trp-cage from the original DNA sequence. Be specific about direction (5’-3’) in which mRNA comes off of the DNA. Show where a small piece of the mRNA is complementary to the original DNA in the correct direction. Where in the cell do these steps take place? Basically, demonstrate that you fully understand exactly how transcription and translation take place. You do NOT need to name every enzyme. Just the major ones.

d. There are no introns in DNA sequence you derived from the known protein structure. Why not?

I need help with Part B. I believe that part A is correct.

4.

a) You also wish to synthesize a degenerate oligonucleotide primer that could be used eventually to clone DNA that encodes your mutant protein. Design this degenerate oligo, keeping in mind the rules we talked about in class. More information about designing degenerate primers and primers in general are located on the following page.

Write out the sequence of this oligo here based on this amino acid sequence (Met Ala Pro Met Val Ala Glu):

My answer (Is it correct?)

I got:

5’ AUG - (GCU/C/A/G) - (CCU/C/A/G) - (AUG) - (GUU/C/A/G) - (GCU/C/A/G) - (GAA/G) ‘3

3’ UAC - (CGA/G/U/C) - (GGA/G/U/C) - (UAC) - (CAA/G/U/C) - (CGA/G/U/C) - (CUU/C) 5’

______________________________________________________________________________

______________________________________________________________________________

(What I actually need help with and have no idea where to begin. Please help me)

b) If you synthesized the above oligonucleotide primer, how many different oligos would be present in the mixture?



Follow these rules Modified from the Thermo Fisher web site:

Designing degenerate primers:

Write out your amino acid sequence, label amino and carboxy termini

For each amino acid, use the genetic code to predict the various nucleic acid codons that can encode this amino acid. For all but Met, you should have redundancy present.

Now you need think about 5’ and 3’ considerations, and keep in mind that DNA within genes is double-stranded. It is helpful to keep in mind that the 5’ end of a gene corresponds to the amino terminus of a protein. Using 5’ and 3’ labels write out a single strand DNA sequence corresponding to the your amino seq of interest. You may choose to start with only possible codon for each amino acid, or you can do all possibilities using the notation I showed you in class to account for the wobble position of codons.

Now make your DNA double stranded by filling in the opposite DNA strand; label the 5’ and 3’ ends of this second strand and make sure you have an anti-parallel arrangement of DNA strands.

If you haven’t already, now consider the redundancy present on both strands, and make sure you have indicated sequences that account for all possible redundancies.

Realize that when a researched synthesizes a degenerate oligo that the final synthesis contains oligos with every substitution possible. The amount of degeneracy is defined by the number of different primer combinations in the mix. You can determine the degree of degeneracy by multiplying the number of changes present at each position together. If a position has no degeneracy then you multiple by 1 for that position.

Keep in mind that the trade-off between primer specificity and efficiency can be modified by altering the degeneracy of the primer. For example, the more degenerate the primers, the less specific annealing will be; however, decreased degeneracy will allow more potential to identify unknown variants. Anything over 1024 fold degeneracy is at the upper limit of potential usefulness.

2

a) You also wish to synthesize a degenerate oligonucleotide primer that could be used eventually to clone DNA that encodes your mutant protein. Design this degenerate oligo, keeping in mind the rules we talked about in class. More information about designing degenerate primers and primers in general are located on the following page.

Write out the sequence of this oligo here

b) If you synthesized the above oligonucleotide primer, how many different oligos would be present in the mixture?

RULES TO FOLLOW for creating primers (Modified from the Thermo Fisher web site):

Designing degenerate primers:

Write out your amino acid sequence, label amino and carboxy termini

For each amino acid, use the genetic code to predict the various nucleic acid codons that can encode this amino acid. For all but Met, you should have redundancy present.

Now you need think about 5’ and 3’ considerations, and keep in mind that DNA within genes is double-stranded. It is helpful to keep in mind that the 5’ end of a gene corresponds to the amino terminus of a protein. Using 5’ and 3’ labels write out a single strand DNA sequence corresponding to the your amino seq of interest. You may choose to start with only possible codon for each amino acid, or you can do all possibilities using the notation I showed you in class to account for the wobble position of codons.

Now make your DNA double stranded by filling in the opposite DNA strand; label the 5’ and 3’ ends of this second strand and make sure you have an anti-parallel arrangement of DNA strands.

If you haven’t already, now consider the redundancy present on both strands, and make sure you have indicated sequences that account for all possible redundancies.

Realize that when a researched synthesizes a degenerate oligo that the final synthesis contains oligos with every substitution possible. The amount of degeneracy is defined by the number of different primer combinations in the mix. You can determine the degree of degeneracy by multiplying the number of changes present at each position together. If a position has no degeneracy then you multiple by 1 for that position.

Keep in mind that the trade-off between primer specificity and efficiency can be modified by altering the degeneracy of the primer. For example, the more degenerate the primers, the less specific annealing will be; however, decreased degeneracy will allow more potential to identify unknown variants. Anything over 1024 fold degeneracy is at the upper limit of potential usefulness.

Designing Primers:

Good primer design is essential for a successful PCR reaction. There are many factors to take into account when designing the optimal primers for your gene of interest. This information is taken from the Fisher Scientific website and are used when actually designing an experiment. Here are some tips to consider when designing primers.

In general, a length of 18 nucleotides is the minimum necessary for efficient primer binding.

Try to make the melting temperature (Tmm) of the primers between 65°C and 75°C, and within 5°C of each other.

If the Tmm of your primer is very low, try to find a sequence with more GC content, or extend the length of the primer a little.

Aim for the GC content to be between 40 and 60%, with the 3' of a primer ending in C or G to promote binding. This is called a GC clamp.

Typically, 3 to 4 nucleotides are added 5’ of the restriction enzyme site in the primer to allow for efficient cutting. Restriction enzymes are ENDO nucleases, so they cut better when their recognition site is not on the end of DNA.

Try to avoid regions of secondary structure, and have a balanced distribution of GC-rich and AT-rich domains.

Avoid intra-primer homology (more than 3 bases that complement within the primer) or inter-primer homology (forward and reverse primers having complementary sequences). These circumstances can lead to self-dimers or primer-dimers instead of annealing to the desired DNA sequences.


Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in