Researchers studying a human growth factor receptor gene found that two types of protein are synthesized from this gene. The two proteins act differently and are transported to different parts of the cell. How do you think the cell is able to synthesize both of these from the same gene template?

answer

watching

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Nestor RutherfordLv2

18 Apr 2019

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

Related questions

You have discovered a new gene âXâ that appears to be regulated by 3 transcription factors (E2F, SP-1 and C/EBPa). Another gene âYâ appears to also be regulated by these same proteins. Both genes are involved in cell cycle initiation but gene Y is expressed later in the cell cycle than gene X.

The DNA sequence at the promoter region is GCGCCAATGTGCTGACAGTTAATTAGGGCTA

The known DNA consensus sequence for each Transcription Factor is:

E2F â GCCAATGTGCTGA

SP-1 â GCTGACAGTTAA

C/EBPa â ACAGTTAATTAGG

It is not known which protein(s) are binding to their respective DNA consensus sequences. It is possible for one protein to be interacting with one another and not directly to the DNA. It is also possible for a transcription factor to use all or only a majority of the DNA consensus sequence. Both scenarios are possible. Discuss in general how protein:DNA and potein:protein interactions occur at the molecular level. Propose an explanation for what you believe may be happening and then design a series of experiments that will investigate the regulation of Gene X and Gene Y. All proteins and gene sequences are known. You have a large well-funded lab.

A human gene called the Î²-globin gene encodes a polypeptide that functions as a subunit of the protein known as hemoglobin. Hemoglobin is found within red blood cells; it carries oxygen. In human populations the Î²-globin gene can be found as the common allele known as Hb^A, and it can also be as the Hb^S allele. Individuals who have two copies of the Hb^S allele have the disease called sickle cell disease. Are the following examples descriptions of genetics at the molecular, cellular, organism, or population level?

A. The Hb^Sallele encodes a polypeptide that functions slightly differently from the polypeptide encoded by the Hb^Aallele.

B. If an individual has two copies of the Hb^Sallele, that persons red blood cells take on a sickle cell shape.

C. Individuals who have two copies of the Hb^Aallele do not have sickle cell disease, but are not resistant to malaria. People who have one Hb^Aallele and one Hb^S allele do not have sickle cell disease but are resistant to malaria. People who have two copies of the Hb^Sallele have sickle cell disease, and this disease may significantly shorten their lives.

D. Individuals with sickle cell disease have anemia because their red blood cells are easily destroyed by the body.

rosewhale208

When the gene is transformed into bacterial cells, no expressed protein is detected. The senior graduate student you work with suggested that since this is a human protein, it is possible that the codon usage is different, so the protein is not expressed because the transcription needs these rare codons. While dealing with the problem of protein expression, you check the pellet of your cell lysate on an SDS gel, and you realize that the protein is expressed but all of it ends up in the pellet. Do you think that the rare codon usage of the gene is the reason your expressed protein is found here? Explain how you draw the conclusion? Now what do you plan to do to improve the expression? Give two suggestions.â