🏷️ LIMITED TIME OFFER: GET 20% OFF GRADE+ YEARLY SUBSCRIPTION →
Log in
Biology
2
answers
0
watching
174
views
31 Jul 2018

1. (20pts) Let’s consider how restrictive enzymes work. Look the two samples of DNA shown below:

DNA Sample #1

5’– T C C A G T G A T C T C G A A T T C G C T A G T A A C G T T C G A T

3’– A G G T C A C T A G A G C T T A A G C G A T C A T T G C A A G C T A

DNA Sample #2

5’– T C A T C G A A T T C C T G G A A T C A G C A G A A T T C G C A T A

3’– A G T A G C T T A A G G A C C T T A G T C G T C T T A A G C G T A T

If both samples are treated with the restriction enzyme EcoRI [recognition sequence G’AATTC] then indicate the number of fragments and the size of each fragment from each sample of DNA. List the fragment sizes in order of largest to smallest.

Sample # 1 Sample # 2

# of fragments:________ # of fragments:________

Sizes of fragments (largeà small): Sizes of fragments (largeà small):

(20pts) Read the protocol for Lab 8B.

What is supercoiled DNA

Why would it migrate further into an agarose gel if it’s uncut plasmid DNA?

What causes this type of DNA to form?

Is this likely to occur to our isolated plasmid DNA?

Watch
2
answers
0
watching
174
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share
Beverley Smith
Beverley SmithLv2
1 Aug 2018
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

Background info:

You have identified an organism with the smallest known genome (sequence below). You isolate the DNA and digest it with EcoR1

EcoRI --- 5' G ↓AATTC 3'

5' ACGACGTATTAGAATTCTTATCCGCCGCCGGAATTCTCATCA 3'

3’ TGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’

Look for palindromic site, specific for restriction enzyme, each strand of the DNA is “cut” (phosphodiester bond of backbone is cleaved) at the same place in the sequence, this will produce sticky ends

The key steps in the experiment:

1. Extract DNA from organism (how would you do this, can you separate protein and nucleic acids, what about DNA from RNA)

2. Incubate DNA with restriction enzyme (what is you used the wrong enzyme? What if you accidentally boiled your sample?

3. Use gel electrophoresis to separate out DNA fragments by size (need a gel, need an electrical current, buffer)

4. Use Ethidium Bromide (EtBr) either in the gel or as a stain afterwards (this will allow for visualization of the DNA, non-specific, ring structure intercalates with bases, excited by UV light, emits orange light)

5. Include a ladder/controls – (you need ladder or something of known size if you want to estimate the size of the fragments)

6. Visualize with UV light source and imager

7. Important – maybe not as key - Use loading dye when loading DNA buffer (the buffer helps the DNA settle into the well, dye lets you approximate where the DNA should be in the gel as it is running)

______________________________________________________________________________________

Here is the question I would like to know:

1) What would happen if we changed something in the experiment?

A) What would happen if we changed step 1?

b) What would happen if we changed step 2?

c) What would happen if we changed step 3?

d) What would happen if we changed step 4?
e) What would happen if we changed step 5?

f) What would happen if we changed step 6?

g) What would happen if we changed step 7 (if anything) ?

1. In a successful PCR reaction, which of the following is true?

a. The template DNA is added in excess of the primers and dNTPs.

b. The annealing temperature must be just below the melting temperature of the primers.

c. The temperature for the denaturation step is 72 C

d. All of the above

2. In our TLC experiment, which of the following had an effect on the migration of the samples?

a. The number of negatively charged phosphate groups

b. The protonation state of ionizable groups on the bases.

c. The size of the molecule.

d. All of the above

3. Which of the following is true of nucleic acid migration in agarose gel electrophoresis?

a.Nicked circular plasmids migrate faster than supercoiled plasmids.

b.Binding of ethidium bromide during electrophoresis speeds up the movement of linear fragments.

c.A higher percentage of agarose will decrease the migration of larger DNA fragments.

d.A lower strength electric field will increase the migration of DNA fragments.

4.What is the purpose of the outgrowth period during transformation?

a.To allow for the cells to take up DNA.

b.To allow for expression of the lacZα and lacZω genes.

c.To allow for expression of antibiotic-resistance genes.

d.To prepare cell membranes for electroporation.

5.Which of the following is true of ligase and ligation reactions?

a.Ligase facilitates H-bonds between the sticky ends created by restriction enzyme digestion.

b.Ligase is inactivated at 37 C.

c.DNA fragments must have a 5’ PO4 group for ligase to covalently join them together.

d.Vector must be added in molar excess to insert to favor recombinant plasmid formation.

Related Documents

BIO206H5 Lecture Notes - Lecture 10: Restriction Enzyme, Recognition Sequence, Plasmid
ceruleancaribou640
BIO370Y5 Lecture Notes - Lecture 4: Bamhi, Hindiii, Plasmid
cyantortoise885
BIO 2306
Final Exam
Study Guide
BIO 2306 Study Guide - Quiz Guide: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Ti Plasmid
skycamel742

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in