Log in
Biology
1
answer
0
watching
326
views

What is the polymerase chain reaction(PCR)? How can this procedure beuseed to amplify and clone any DNA fragment? Why is DNA polymerase from thermus aquaticus used in the reaction?

Watch
1
answer
0
watching
326
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Jean Keeling
Jean KeelingLv2
28 Sep 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the discovery of a bacterium called Thermus aquaticus in a hot spring inside Yellowstone National Park, in Wyoming. This organism contains a heat-stable form of DNA polymerase known as Taq polymerase, which continues to function even after it has been heated to 95°C. Why would such a heat-stable polymerase be beneficial in PCR?

What would happen if it weren’t heat stable?

How might you choose a region of DNA for a PCR primer so as to increase the temperature necessary for primer annealing (to minimize nonspecific PCR products)?

A PCR reaction begins with 5 double stranded segment of DNA. Estimate the number of double-stranded copies of DNA that are present after the completion of 15 amplification cycles?

1.The PCR (polymerase chain reaction) protocol that is currentlyused in laboratories was facilitated by the discovery of abacterium called Thermus aquaticus in a hot spring insideYellowstone National Park, in Wyoming. This organism contains aheat-stable form of DNA polymerase known as Taqpolymerase, which continues to function even after it has beenheated to 95°C.

a.Why would such a heat-stable polymerase be beneficial inPCR?

b.What would happen if it weren’theat stable?

c.How might you choose a regionof DNA for a PCR primer so as to increase the temperature necessaryfor primer annealing (to minimize nonspecific PCRproducts)?

d.A PCR reaction begins with 5double stranded segment of DNA. Estimate the number ofdouble-stranded copies of DNA that are present after the completionof 15 amplification cycles?

PCR Homework

Design a forward and a reverse primer ( 15 bases length ) to amplify the next DNA sequence

5’GGTGGTGCGCTTCCAAGAAGCAGCCAATAAGCAGAAGCAGGAACTCGACGAGATCTCGACGAATATTCGTCAGGCCGGCGTCCAATACTCGAGGGCCGACGAGGAGCAGCAGCAGGCGCTGTCCTCGCAAATGGGCTTCTGA3’

Name the reagents needed to do a PCR reaction

What is a DNA polymerase and why this enzyme from a thermoresistant microorganism must be used for the PCR?

The forward primer binds to the _____________ DNA chain and the ___________ primer bind to the main DNA chain that is the reason why we have to use the reverse _________ sequence to design the second primer

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in