Biochem:
The following DNA template strand will be used for questions1-3: 3'- ATATCATCAGCA-5'
1. Reverse transcriptase is able to make DNA from RNA. Given theDNA segment from above, what would be the corresponding RNAsequence?
2. Suppose a problem with synthesis of nucleotides occurs thatcauses deoxygination of the 3' oxygen of deoxyribose of allcytosine bases, and only cytosine bases. What would be thesequences of the replicated strands of DNA?
3. Provide a method for how the scenario in question 2 could beused to create a method of sequencing. What molecular technique isthis similar to? What would the gel look like for the templatestrand?
4. Suppose that a deamination of a pyrimidine that iscomplementary to Guanine occurs in a strand of DNA. Explain theresulting problem and the process that is used to fix it.
5. Explain the properties of histones that allows for DNA to bepacked so closely together. BE sure to include the role that aminoacids play in this.
6. Suppose the sequence GGAUC is repeated infinitely. How manyamino acids would you find? List the amino acids you would find inthis motif.
7. Which of the following was improperly matched with a possibleanticodon?
a. M-AUG
b. Y-AUA
c. W-ACC
d. N-UUC
e. Q-GAG
f. A and C
g. A,D, and E
8. What is a lariat intron intermediate and explain the processused to temporarily create it?
Biochem:
The following DNA template strand will be used for questions1-3: 3'- ATATCATCAGCA-5'
1. Reverse transcriptase is able to make DNA from RNA. Given theDNA segment from above, what would be the corresponding RNAsequence?
2. Suppose a problem with synthesis of nucleotides occurs thatcauses deoxygination of the 3' oxygen of deoxyribose of allcytosine bases, and only cytosine bases. What would be thesequences of the replicated strands of DNA?
3. Provide a method for how the scenario in question 2 could beused to create a method of sequencing. What molecular technique isthis similar to? What would the gel look like for the templatestrand?
4. Suppose that a deamination of a pyrimidine that iscomplementary to Guanine occurs in a strand of DNA. Explain theresulting problem and the process that is used to fix it.
5. Explain the properties of histones that allows for DNA to bepacked so closely together. BE sure to include the role that aminoacids play in this.
6. Suppose the sequence GGAUC is repeated infinitely. How manyamino acids would you find? List the amino acids you would find inthis motif.
7. Which of the following was improperly matched with a possibleanticodon?
a. M-AUG
b. Y-AUA
c. W-ACC
d. N-UUC
e. Q-GAG
f. A and C
g. A,D, and E
8. What is a lariat intron intermediate and explain the processused to temporarily create it?
Related textbook solutions
Related questions
Question 4
Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)
| Guanine histone Double helix Adenine conservative cytosine | Okazaki fragments Thymine introns Leading strand RNA polymerase 5-prime to 3-prime | Uracil chromatin DNA ligase Semi-conservative promoter | Lagging strand DNA polymerase nucleosomes Electron transport chain enhancer |
Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.
Question 5
In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."
| Lactose | Glucose | Lac expression? |
| No | Yes | |
| Yes | Yes | |
| Yes | No |
Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.
Question 6
Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)
a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:
5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â
b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.
c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?
