🏷️ LIMITED TIME OFFER: GET 20% OFF GRADE+ YEARLY SUBSCRIPTION →
Log in
Biology
1
answer
0
watching
59
views

Question 1)

Making genetically engineered catfish would be easier than making genetically engineered cows at what step?

A) modfiying the transgene

B) collecting fertilized eggs.

C) producing offspring once a fertilized egg with a transgene introduced into the cell is obtained

D) both b and c above

Question 2)

A transgene designed to be expressed in milk and encode a bacterial protein would:

A) have the bacterial gene promoter and coding region
B) would need to be placed in just the mammary cells

C) have a promoter from a human mammary cell specific gene and the coding region from the bacteria gene

D) have a promoter from a human mammary cell specific gene and the coding region from this same gene.

Question 3)

What is the part of the gene that is the on/off signal?

A) termination sequence

B) promoter

C) coding region

D) Trick question, genes do not need to be signaled to turn on or off. Every gene is always turned on in every cell.

Watch
1
answer
0
watching
59
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Jarrod Robel
Jarrod RobelLv2
28 Sep 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

1. You have cloned a human gene along with its promoter and ribosome-binding site in a bacterial cloning vector and then introduced the recombinant plasmid into a bacterial host cell that supports the replication and segregation of the cloning vector. Unfortunately, even though you know the whole human gene sequence is present (by DNA hybridization); you cannot get expression of the gene. Which of the following is NOT a reason why there is no expression?

A. The vector cannot replicate

B. The human promoter is not recognized by the bacterial host cell

C. The ribosome-binding site is not recognized by the bacterial host cell

D. The human gene lacks introns, so it is not transcribed by the host bacterium

2. Restriction endonucleases are:

A. sequence-specific

B. able to recognize any 4-, 6-, or 8-base pair sequence

C. always able to produce single stranded tails

D. only able to cleave bacterial DNA

3. Which of the following is NOT a required characteristic of cloning vectors?

A. Genes for replication of vector DNA and segregation to progeny cells

B. Genes for selection of cells carrying the vector (e.g., antibiotic-resistance)

C. DNA sequence for the introduction of foreign DNA where the integrated DNA does not disable the vector

D. None of the above

4. A poly (T) primer is used to produce cDNA from mammalian mRNA. Which of the following would be used to produce cDNA from bacterial mRNA?

A. A poly (T) primer

B. A random DNA sequence primer

C. A poly (A) primer

D. A poly (GC) primer

Use this list of gene elements to answer the following questions: (a) Promoter
(b) Exon
(c) Enhancer

(d) Intron
(e) 5’ untranslated region

(f) 3’ untranslated region

Problem 1. Which of the above gene elements are transcribed? You may choose more than one answer.

Problem 2. Which of the above gene elements are translated? You may choose more than one answer.

Problem 3. Which of the above gene elements are regulatory? You may choose more than one answer.

Problem 4. Which of the above gene elements are coding? You may choose more than one answer.

Problem 6. A mutation occurs in a gene with the following sequence: AAGCT. An example of a deletion mutation in this sequence would be AACT (loss of G). Using AAGCT as your normal sequence, give an example for the following types of mutations

(a) Insertion (b) Transition

(c) Transversion

Problem 7. A mutation occurs in the coding region of a gene with the following sequence AAGTGC. The translated sequence is Lysine (AAG), Cysteine (TGC). Give an example of following types of mutation using AAGTGC as your normal sequence. Provide the translated sequence caused by the mutation. (Hint: You will need a codon table to translate the sequence)

(a) Synonymous mutation
(b) Non-synonymous missense mutation

(c) Non-synonymous nonsense mutation
Problem 8-10. You are an oncologist with three patients:

Problem 8. Patient 1 has a tumor causing mutation in a pro-growth gene. The mutated protein allows the cell to grow without receiving growth signals from outside the cell. Is the mutated gene an oncogene or a tumor suppressor? Why? Which hallmark is the gene associated with?

2

Problem 9. Patient 2 has a tumor which contains a loss of function mutation in the P53 gene. How would you determine if it is a somatic or germ line mutation?

Problem 10. Patient 3 has a tumor causing mutation in a gene called telomerase. The function of telomerase is to lengthen the ends of chromosomes. What hallmark is telomerase associated with? Is the mutation gain of function or loss of function? (Hint: to answer this question, you need to understand which hallmark telomere length is associated with)

Here you have the non-template strand of DNA sequences of genomic DNA and mRNA of the human insulin gene (1431nt long from +1nt).

……….CAAT…..<60nt>…..TATA..<28nt>..AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGTGGGCTCAGGATTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGGTGAGCCCAGGGGCCCCAAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCCCTGCCTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACTGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTGCTCCTGGCGCTCCCACCCAGCATGGGCAGAAGGGGGCAGGAGGCTGCCACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAAGAAGTTCTCTTGGTCACGTCCTAAAAGTGACCAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTGAGGACGGTGTTGGCTTCGGCAGCCCCGAGATACATCAGAGGGTGGGCACGCTCCTCCCTCCACTCGCCCCTCAAACAAATGCCCCGCAGCCCATTTCTCCACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGTAAAGTCCTGGGTGACCTGGGGTCACAGGGTGCCCCACGCTGCCTGCCTCTGGGCGAACACCCCATCACGCCCGGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGACCCCTGTCGCCAGGCCTCACGGCAGCTCCATAGTCAGGAGATGGGGAAGATGCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCCCACTGTGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGGGCGTTGGGGCCTGTAGGTCCACACCCAGTGTGGGTGACCCTCCCTCTAACCTGGGTCCAGCCCGGCTGGAGATGGGTGGGAGTGCGACCTAGGGCTGGCGGGCAGGCGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCCGGAACCTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCCGCAGGCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGC

The mRNA strand is as follows:

mRNA sequence (465nt long)

AGCCCUCCAGGACAGGCUGCAUCAGAAGAGGCCAUCAAGCAGAUCACUGUCCUUCUGCCAUGGCCCUGUGGAUGCGCCU CCUGCCCCUGCUGGCGCUGCUGGCCCUCUGGGGACCUGACCCAGCCGCAGCCUUUGUGAACCAACACCUGUGCGGCUCA CACCUGGUGGAAGCUCUCUACCUAGUGUGCGGGGAACGAGGCUUCUUCUACACACCCAAGACCCGCCGGGAGGCAGAGG ACCUGCAGGUGGGGCAGGUGGAGCUGGGCGGGGGCCCUGGUGCAGGCAGCCUGCAGCCCUUGGCCCUGGAGGGGUCCC UGCAGAAGCGUGGCAUUGUGGAACAAUGCUGUACCAGCAUCUGCUCCCUCUACCAGCUGGAGAACUACUGCAACUAGA CGCAGCCCGCAGGCAGCCCCACACCCGCCGCCUCCUGCACCGAGAGAGAUGGAAUAAAGCCCUUGAACCAGC

QUESTIONS:

1) Label the following on the DNA strand:

a) +1 position

b) upstream and downstream sequence relative to +1 nucleotide

c) Promoter region

d) Exons

e) introns

f) splicing signals (dinucleotides)

2. Label the following on the mRNA strand:

a) Start codon

b) stop codons

C) Kozak sequence

3. If you placed this gene (human insulin) in a bacterial cell, do you think a functional insulin product will be made? Why or why not?

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in