🏷️ LIMITED TIME OFFER: GET 20% OFF GRADE+ YEARLY SUBSCRIPTION →
Log in
Biology
1
answer
0
watching
76
views

Which is both successful yet very damaing sequence in out genome from an evolutionary perspective?

5' UTRs

3' UTRs

satellite sequences

repetitive sequences

retrotransposons

Watch
1
answer
0
watching
76
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Beverley Smith
Beverley SmithLv2
29 Sep 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

1) In Eukaryotes, repetitive sequence inclues:
A) Centromere sequences
B) Telomere sequences
C) All of the above

2) Satelit DNA:
A) Was orignally discoverd in E. Coli
B) Represents plasmid DNA sequences
C) Contains repetitive DNA sequences
D) Has the same density as main band DNA
E) All of the above

3) Inversions _____ The number of crossover offspring.
A) Decrease
B) Increase
C) Do not change
(I Believe the answer is "C" ^. can you explain why?)

4) In human genome, repetitive DNA is estimated to be ___ of the total genome.
A) .1%
B) 1%
C) 10%
D) 50%
E) 90%

5) In E. Coli, the promoter sequence:
A) Contains a short AT rich sequence
B) Binds transcription factors
C) All of the above

6) In eukaryotic transcription:
A) Transcription factors bind to the promoter and then RNA polymerase binds.
B) Transcription factors bind to RNA polymerase which then binds to the promoter
C) Transcription factors are NOT required to initiate transcription

Explanation for each would help immensely. THANK YOU in advance for your time!!!

Please answer everything

1. Which of the following choices most accurately describes the proteins that form the linker histones of the chromatosome?

A) H2A, H2B, H3, H4

B) H2A, H1t, H5, H3

C) H5, H1a-e, H1t, H10

D) H3A, H1, H4A, H5

2. Which of the followings is not an example of randomly repeated DNA?

A) Minisatellites

B) Alphoid DNA in Centromere

C) Retrotransposons

D) Microsatellites

3) Which of the followings is not found in the human genome?

A) Long interspersed nuclear repeat

B) Short interspersed nuclear repeat

C) Insertional sequence

D) Long terminal repeat

4) Which of the following is not true?

A) Major portion of human genome is placed by repetitive sequences

B) The yeast genome is very compact

C) The higher eukaryotic organisms always have more complex genome

D) The genes make up only a small part of the human genome

5) What does the functional analysis of genome suggest the researchers about eukaryotic organisms?

A) All eukaryotic organisms have the same numbers of genes in each functional category.

B) All eukaryotic organisms have approximately the same number of genes.

C) Complex organisms have a larger portion of unknown genes

D) Complex organisms have greater numbers of genes in each functional category

E) Simpler organisms contain many fewer types of gene when compared to complex organisms

1. Given the sequence labeled "original" below, identify thepoint mutations in the mutant sequence below, and determine whichare silent, missense, or nonsense. Assume both sequences are partof a coding strand with an upsteam code. (6 points) 5'-AGTCCATGCCCC -3' -----------original sequence 5'- AGCCAATGACGC-3'------------mutant sequence

2. Which sequence below, A or B, would you expect to be a morelikely target sequence for the formation of pyrimidine dimers whenexposed to UV light in the 254 nm range? Explain your answer. (4points) A. GTACGTACATGT CATGCATGTACA B. TGTATCCTAGCTACATAGGATCGA

3. An mRNA has the sequence 5'-AUGCCAAUAGCACACAAAGCA-3',translating to Met-Pro-Ile-Ala-His-Lys-Ala. (4 points) a. Whathappens if you change the first C to a G? b. What happens if youdelete the first C?

4. The human genome has about 300,000 copies of atransposon-like repetitive element known as an Alu repeat. Theseelements have recently been shown to be the source of geneticdisease. Describe a mechanism by which Alu elements could causedisease. (6 points)

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in