Consider mutation was to occur in the given strand: 5'ATGCATATTTGCCA3'; what would the mRNA sequence and the peptide sequence look like.

answer

watching

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Patrina SchowalterLv2

16 Jul 2018

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

Related questions

Given the following parent strand sequence, what would thedaughter strand sequence look like? Note the given orientations ofthe strands..
5

graybee653

Below is a DNA sequence that is a template strand and contains an Open reading frame for a gene:

3â TAAACTGTACAGGGCCATAACT 5â

A. Find the open reading frame and circle the start and stop codon.

B. Transcribe the open reading frame into a strand of mRNA

C. What is the peptide encoded by this strand of mRNA?

D. Consider the 2nd translated codon from the mRNA strand. What is the probability that a single base change in any position of this codon would change the identity of the second amino acid in the protein sequence?

One strand of a section of DNA isolated from E. coli reads 5â -GTAGCCTACCCATAGG-3â A. Suppose that an mRNA were transcribed using the complement of this DNA strand as a template. What would the sequence of the mRNA in this region be? B. How many different peptides could potentially be made from this sequence of RNA? Would the same peptides be made if the other strand of DNA served as the template for transcription? C. What peptide would be made if translation started exactly at the 5/ end of the mRNA in Part A? When tRNAAla leaves the ribosome, what tRNA will be bound next? When the amino group of alanine forms a peptide bond, what bonds, if any, are broken, and what happens to tRNAAla?