Log in
Biology
1
answer
0
watching
68
views
12 Feb 2019

Design the primers that you will use for the PCR reaction to amplify the rac gene. Include any additional sequences (for example restriction enzyme sites). (b) (5 points) – Suppose that when you designed your primers, you made a mistake and instead of the correct base (a G) on the 3' end of one of the primers you placed a C nucleotide; explain how this would affect the results of the PCR (if no affect, state that). (c) The PCR product does not contain phosphates on their 5’ends. How can it be ligated into the AT-vector?

Watch
1
answer
0
watching
68
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Trinidad Tremblay
Trinidad TremblayLv2
13 Feb 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

Tom is a molecular biology graduate student who needs to isolate a gene from the pathogenic bacteria Salmonella typhi, which he is studying. He wiselydecides to use PCR to amplify the gene before trying to purify it. The gene has the general structure shown below:

~1000 Base Pairs ! ! 5’-ATGGCTTACGTG-----------CCATAGGGCTAA-3’ ! ! 3’-TACCGAATGCAC-----------GGTATCCCGATT-5’

The gene is about 1000 nucleotide base pairs long, but only the sequences at the ends of the double strand are shown. Use the information from the video, what you learned about base pairing in class, and the fact that PCR always proceeds along the parent DNA strand the 3’ to 5’ direction. Design two, 6-nucleotide long, PCR primers for Tom. When you have these primers designed, proceed to the “Exercises and videos” link. You will be prompted for important information in drop-down menus. Answer each question and click continue to see a first-person performance of a PCR reaction.

Question #1 (These will be multiple choice and are automatically graded) a) What different components will do you want to add to your PCR?

b) Which primers will you use?

c) How many PCR cycles should you set the thermocycler for to obtain 128 TOTAL strands of DNA at the end of the reaction (this includes the template strands that you started with)?

d) To analyze the PCR you need to make a DNA gel. What do you want to add to make the gel?

4. Microsatellites are repeating sequences of 2-6 base pairs ofDNA. KAH is a hypothetical human microsatellite locus with arepeating sequence of CAGA. The locus is shown in the figure with20 bp of flanking DNA sequences that can serve as primers foramplification of the locus by PCR.

5’ GTTACTTAGGTATTGCCGAT KAH ATCTTGTAACCTAT ACTGTG3’

3’ CAATGAATCCATAACGGCTA LOCUSTAGAACATTGGATATGACAC 5’

a. You will use PCR to genotype individuals for the KAH locus.The primers should be 20 nucleotides long. Determine the sequencesfor the two primers required to amplify the KAH locus. Note thatyou must label the 5’ and 3’ ends of both primers. Also, primersequences, by designation, are always written in the 5’ to 3’direction. 1 pt

b. Assume two KAH alleles, one with 8 and another with 5 copiesof the repeating unit. Using the primers you have designed, whatwill be the sizes of the amplified PCR products for each allele? 1pt

c. There are actually four known alleles of the KAH locus with13, 10, 8, and 5 copies of the repeating unit. How many possiblegenotypes are there for these alleles, and what are they? 1 pt

d. One parent is heterozygous for the 13 and 8 alleles of theKAH locus and the other parent is heterozygous for the 8 and 5alleles. The two parents live with three children. When youdetermine the genotype of the two children, the two genotypes are(8, 5) and (13, 10). What can you conclude about the parentage ofthe two children? 1 pt

Hi please help with this its very important for my grade worth 25 points of my grade:

The AT-vector containing the rac PCR sequences AND the expression vector DNA to be used for cloning are digested with XhoI and EcoR1. The fragments were then mixed and joined together before transformation.

(a) (4 points) – Why were two different restriction enzymes used?

(b) (4 points) – If the cloning had been done with only a single restriction enzyme (both PCR primers contained the same restriction enzyme site and the vector was digested with only that one enzyme [for example EcoR1]), what additional step would have to be done to ensure that the correct clone was obtained?

(c) If the vector DNA to be used for cloning is digested with BamH1 and the TA-vetor/rac DNA used for cloning is digested with Sau3A, would using these two enzymes as described work for a cloning experiment? Explain

(d) (4 points) - What is the name of the enzyme used to join the ends of the target and vector DNA molecules together?

(e) (4 points) - What would happen during the ligation reaction if the restriction enzyme was not heat inactivated before the ligation reaction?

(f) (4 points) - Why was it necessary to treat the vector with phosphatase?

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in