Query Sequence: ATATCAGAGCACACTCACGCGGACAGAATGCCGAG
1. Identify the gene from which the query sequence originates (Name of gene)
2. Provide the full protein sequence encoded by the gene (single letter amino acid abbreviation form).
3. Are different splice variants known for this gene? How many?
4. What human disease has been connected to this gene?
5. Calculate molecular weight (kiloDalton [kD]) and the calculated pI of the protein (the pH where the protein carries no net electrical charge).
6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a reference to a web page.
7. Are there homologues for the identified gene in other systems? Identify one homologue in a invertebrate system (if there is none, provide a vertebrate homologue).
8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease etc.) of the protein(s) encoded by the gene.
*9. Generate an protein sequence alignment for one of the identified putative protein products with at least one similar invertebrate protein (if there is none, use a vertebrate homologue).
*10. Generate a secondary structure prediction for one identified protein.
Query Sequence: ATATCAGAGCACACTCACGCGGACAGAATGCCGAG
1. Identify the gene from which the query sequence originates (Name of gene)
2. Provide the full protein sequence encoded by the gene (single letter amino acid abbreviation form).
3. Are different splice variants known for this gene? How many?
4. What human disease has been connected to this gene?
5. Calculate molecular weight (kiloDalton [kD]) and the calculated pI of the protein (the pH where the protein carries no net electrical charge).
6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a reference to a web page.
7. Are there homologues for the identified gene in other systems? Identify one homologue in a invertebrate system (if there is none, provide a vertebrate homologue).
8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease etc.) of the protein(s) encoded by the gene.
*9. Generate an protein sequence alignment for one of the identified putative protein products with at least one similar invertebrate protein (if there is none, use a vertebrate homologue).
*10. Generate a secondary structure prediction for one identified protein.
