BIO 2133 : TXTbook Notes.pdf
Get access
Related textbook solutions
Related Documents
Related Questions
In your mutated sequencereplace the third "G" (3rdG) with an A.
Original Sequence: AUGGCGAACCACGCGCACACCCUG
Mutated Sequence: AUGGCAAACCACGCGCACACCCUG
Which type of mutation is this?
Nonsense mutation | ||
Missense mutation | ||
Silent mutation | ||
Frameshift mutation |
You perform a mutant screen for new recessive mutations that produce white eyes in Drosophila. You isolate 5 new mutants. Consider this complementation table (entries indicate the eye color of offspring of crosses of corresponding maternal and paternal genotypes):
maternal genotype â homozygous for: | ||||||
mutation 1 | mutation 2 | mutation 3 | mutation 4 | mutation 5 | ||
paternal genotype â homozygous for: | mutation 1 | white | red | red | white | red |
mutation 2 | red | white | white | red | red | |
mutation 3 | red | white | white | red | red | |
mutation 4 | white | red | red | white | red | |
mutation 5 | red | red | red | red | white |
How many different mutant genes have you discovered and how do you know?