quyenhoangnuto
0 Followers
0 Following
1 Helped
12 Feb 2023
Answer: 1. b(-3x^2-9x+5)-(4x^2-5x-4)+(-x^2-5x+2)=-8x^2-9x+11 2. b (3a^3*b)^3*(...
10 Feb 2023
Answer: (3x-2)(2x-3) =3x(2x-3)-2(2x-3) =6x2-9x-4x+6 =6x2-13x+6 z(z-1)(z+3)=0 z...
7 Feb 2023
Answer: (f(x+h)-f(x)/h)=(2(x+h)^2+8(x+h)-2x^2-8x)/h=(2(x^2+2xh+h^2)+8x+8h-2x^2...
7 Feb 2023
Answer: (f+g)(x)=f(x)+g(x)==6x^2-2x+3+5x-7=6x^2+3x-4 (f-g)(x)=f(x)-g(x)=2x^2-7...
7 Feb 2023
Answer: =(2(x+h)^2+8(x+h)-2x^2-8x)/h=(2(x^2+2hx+h^2)+8x+8h-2x^2-8x)/h=4hx+2h^2...
7 Feb 2023
Answer: 26)f(2)+g(2)=2^3-8(2)^2+1-(2)^3+8(2)^2-2=-3--> answer c 27)f(x)-g(x...
7 Feb 2023
Answer: f-g=5x+8-(-3x-2)=8x+10
7 Feb 2023
Answer: f+g=5x+8-3x-2=2x+6
7 Feb 2023
Answer: 1.f(3-h)-f(-2)=5(3-h)-1-(5(-2)-1)=15-5h-1+11=-5h+25 2.f(9+h)=-2(9+h)+9...
7 Feb 2023
Answer: (h-f)(x)=h(x)-f(x)=2x^2+x-3-(x^2-x+4)=x^2-7
6 Feb 2023
Answer: h(g(4))=h(2*(4)+f(4-3))=h(8+f(1))=h(8+(1^2+1)=h(8+3)=h(11)=5*11=55
6 Feb 2023
Answer: (f-g)(x)=f(x)-g(x)=5x^2-5x-5-(2x+3)=5x^2-7x-2
6 Feb 2023
Answer: (f+g)(x)=f(x)+g(x)=5x^2+5x+4+3x^2+4x=8x^2+9x+4
6 Feb 2023
Answer: h(x)=3(5x+2)^2-4(5x+2) a)f(g(x))=f(5x+2)=3(5x+2)^2-4(5x+2) answer a
6 Feb 2023
Answer: (h-g)(x)=h(x)-g(x)=3x^3 - 2x^2 + 5x -2-(3x^2 - 4x - 2 )=3x^3+x^2+x-4 g...
3 Feb 2023
Answer: m=0 y-intercept: x=0 --->y=5
2 Feb 2023
Answer: 7a 8b 9b 10c 11a 12b 13b 14b 15c 16c 17c
2 Feb 2023
Answer:B)Lysosome, uniport, active transport because to maintain their acidic ...
31 Jan 2023
Answer: 1. lysosome because lysosome is membrane-bound cell organelle that con...
31 Jan 2023
Answer: form of linear equation:y=ax+b (1) (1) is perpendicular to y=3x-2 --&g...
31 Jan 2023
Answer: angle ADB=angle ADC=90 because AD is the perpendicular bisector of the...
31 Jan 2023
Answer:segments LJ and AF are perpendicular. -->4x+50=90; 7y-50=90---->x...
31 Jan 2023
Answer: from picture : 85+(2y-5)+95+(3x+55)=360 3x+2y+230=360 3x+2y=130 from p...
30 Jan 2023
Answer: 9x^2+y^2=324 x^2/36+y^2/324=1 a=6 b=18 c^2=b^2-a^2=18^2-6^2=288--> ...
30 Jan 2023
Answer: find the standard form ò the ellipse This is the form of an ellipse. U...
30 Jan 2023
Answer: This is the form of an ellipse. Use this form to determine the values ...
30 Jan 2023
Câu trả lời: 29) from the equation: a=4;b=5 the vertices:(4;0);(-4;0);(0;-5);(...
30 Jan 2023
Answer: a) TTATCATGCGCTCAGCACTACTTTAAGA B) UUAUCAUGCCUCAGCACAUCUUUAAGA c) AUGC...
30 Jan 2023
Answer: RNA 5'CCAUGGCAGCUUACC3' 3'GGUACCGUCGAAUGG5' terminator: 5'UAA3' ;5'UAG...
27 Jan 2023
Answer: 1. cervical :7 vertebrae 2.thoracic:12 vertebrae 3.lumbar:5 vertebrae ...
26 Jan 2023
Câu trả lời: 2) từ phương trình có: a= 3; b= 2 c^2=a^2-b^2=3^2-2^2=5 c= Tiêu đ...