Question 1: 

Give an example of how to find an ORF (open reading frame) in a DNA sequence. Provide the appropiate sequence by using ATG as start code and TAG as stop code.

A closed reading frame: A) contains frequent stop codons. B) contains many substitution mutations. C) is formed by the deletion of a sequence from an open reading frame. D) begins and ends with the same sequence. E) produces a polypeptide that serves no apparent function.

Below is a DNA sequence that is a template strand and contains an Open reading frame for a gene:

3’ TAAACTGTACAGGGCCATAACT 5’

A. Find the open reading frame and circle the start and stop codon.

B. Transcribe the open reading frame into a strand of mRNA

C. What is the peptide encoded by this strand of mRNA?

D. Consider the 2nd translated codon from the mRNA strand. What is the probability that a single base change in any position of this codon would change the identity of the second amino acid in the protein sequence?

You have the following gene, TrfA, from a plasmid that grows in E. coli, and you would like to clone it into Clostridium perfringens in order to express the protein. The sequence of the ORF (open reading frame) is below:

atg aat cgg acg ttt gac cgg aag gca tac agg caa gaa ctg atc gac gcg ggg ttt tcc gcc gag gat gcc gaa acc atc gca agc cgc acc gtca tgc gtg cgc ccc gcg

What issue might you run into when you consider expression of this gene, and briefly, how would you solve it? Be specific and give 2-3 examples