BIOL 3P50- Final Exam Guide - Comprehensive Notes for the exam ( 35 pages long!)

198 views35 pages

orangehornet913

30 Nov 2017

School

Department

Course

Professor

For unlimited access to Study Guides, a Grade+ subscription is required.

Document Summary

Dna type: however, rna typically found in cells as single-stranded molecule. Central dogma: transcription: rna synthesis directed by dna template, translation: synthesis of proteins directed by rna template, unidirectional rna sequences are never determined by protein templates nor is dna made on. Genomics: advent of rapid, automated dna sequencing methods has led to determination of complete genome sequences. Identification of sequences that direct gene expression, dna replication, chromosome segregation, and recombination can all be facilitated by comparing genome sequences. High-energy bonds: formation of covalent bonds involves an increase in free energy, monomeric precursors are converted to high-energy activated precursors using energy of atp, which spontaneously unite to form larger molecules. In right handed dna, glycosidic bonds are in anti conformation. Individual folded chains associate with each other: way in which subunits associate does not change how individual polypeptides fold, components of a protein oligomer depend on association with each other.

Related Questions

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BIOL 3P50- Final Exam Guide - Comprehensive Notes for the exam ( 35 pages long!)

Document Summary

Get access

Related Documents

BIOL 3P50 Lecture Notes - Lecture 2: Purine, Thymine, Genetic Disorder

BIOL 3P50 Lecture Notes - Lecture 5: Ribonuclease P, Counterion, Intron

BIOL 3P50 Lecture 4: Chapter-4

Related Questions