BIO206H5 Study Guide - Final Guide: Noncoding Dna, Transfer Rna, Cistron

993 views4 pages
18 Feb 2016
School
Department
Course
Michelle Chyjek (1001326371)
BIO206 - TUT0113
Transcription Worksheet
1. a) I would expect high levels of error in transcription as compared to DNA replication, given that RNA
polymerase does not proofread. Proofreading in DNA replication is important because the DNA
sequence synthesized is passed on to offspring, so there cannot be any mistakes in the genetic code
as they could be detrimental. RNAs, on the other hand, do not exist for very long periods of time in the
cytoplasm, so their mistakes are not permanent. In addition, there a many different codon triplets code
for the same amino acids, so if there is only one slight variation in the codon, it may not affect the
overall protein structure.
b) The significance of this difference is that transcription can occur much quicker and more efficiently
than RNA replication. Since transcription can proceed quickly, translation can proceed quickly and
proteins can be synthesized at a very fast rate.
2.
Prokaryotes Eukaryotes
Start Signals
The start signals are called
promoters:
1. -10 (TATAAT)
2. -35 (TTGACA)
The start signals are called
promoters:
1. -25 (TATA)
2. -70 (GG(C/T)CAATCT)
Stop Signals Transcription termination sequence
3.
4. 5' C C A U C A U G A C A G A C C C U U G C U A A C G C 3' RNA
5. In prokaryotes, the mRNA (transcriptional unit) can contain more than one translational unit or protein
coding sequence. These mRNAs are called polycistronic. In eukaryotes, however, polycistronic mRNAs
are not possible.
6.
CTTGACACCATCGAATGGCGCAAAACCTTTCGCGGTATAATGGAGCGC C CGGAAGAGAGTC
GAACTGTGGTAGCTTACCGCGTTTTGGAAAGCGCCATATTACCTCGCG G GCCTTCTCTCAG
Unlock document

This preview shows page 1 of the document.
Unlock all 4 pages and 3 million more documents.

Already have an account? Log in

Document Summary

Bio206 - tut0113: a) i would expect high levels of error in transcription as compared to dna replication, given that rna polymerase does not proofread. Proofreading in dna replication is important because the dna sequence synthesized is passed on to offspring, so there cannot be any mistakes in the genetic code as they could be detrimental. Rnas, on the other hand, do not exist for very long periods of time in the cytoplasm, so their mistakes are not permanent. Since transcription can proceed quickly, translation can proceed quickly and proteins can be synthesized at a very fast rate. The start signals are called promoters: -10 (tataat, -35 (ttgaca) The start signals are called promoters: -25 (tata, -70 (gg(c/t)caatct) In eukaryotes, however, polycistronic mrnas are not possible. Bio206 - tut0113: a) if a cell did not have any sigma factors, the rna polymerase would not bind to the correct initiation region of the dna.

Get access

Grade+
$10 USD/m
Billed $120 USD annually
Homework Help
Class Notes
Textbook Notes
40 Verified Answers
Study Guides
Booster Classes