Textbook Notes (368,276)
Canada (161,758)
Chapter 10

Notes Chapter 10 (Lectures 1-4) - Biochem 2B03.docx
Premium

13 Pages
84 Views
Unlock Document

Department
Biochemistry
Course
BIOCHEM 2B03
Professor
Margaret Fahnestock
Semester
Fall

Description
Biochem 2B03 Jasmyn Lee Chapter 10: Nucleotides and Nucleic Acids Nucleic Acids  Very big molecules  RNA: Ribonucleic Acid  DNA: Deoxyribonucleic Acid  Really Big Molecules Source of info Number of cells in an adult 1014 (100 trillion) Science Netlink 9 Number of base pairs in a human cell 6 x 10 (6 billion) Human Genome Project -9 Average height (meters) of a base pair0.34 x 10 (0.34 nanometer) Everyone knows that... Meters of DNA in a human cell 2.04 m Do the math... 14 Meters of DNA in a human adult 2.04 x 10 
(200 billion km) See above 11 How impressive? Making 650 return trips from Earth Earth to Sun distance = 1.5 x 1m to Sun Wikipedia 7 20 million times across Earth Earth diameter = 1.3 x 10 m. Wikipedia  And there’s quite a lot of them around  Source of info Number of cells in an adult 1014 (100 trillion) Science Netlink 9 Number of base pairs in a human cell 6 x 10 (6 billion) Human Genome Project Average molecular weight of a base pair660 Daltons Textbook Daltons of DNA in a human cell 3.96 x 102 6 x 10 x 660 Daltons -12 1 Dalton = 1.66 x 104 g (1 Dalton = Grams of DNA in a human cell 6.57 x 10 (~6 picogram) 1/N gram) A Grams of DNA in a human adult 657.36 (~1.5 lbs) 14 -12 10 x 6.57 x 10 % body weight (150-lbs) 1% We learn about DNA by determining its sequence  1970-77; Competition between Walter Gilbert (Harvard) and Frederick Sanger (Cambridge) o Gilbert – chemical sequencing; 24 bp lac operator, 1973  5'TGGAATTGTGAGCGGATAACAATT3‘ o Sanger – sequencing with oligos and DNA polymerase I; 50 bp of phage fl, 1973 1 Biochem 2B03 Jasmyn Lee  5'ACCATCCAATAAATCATACAGGCAAGGCAAAGAATTAGCAAAATTAAGCAATAAAGCC3‘ o Maxam and Gilbert – 100 bp of lac operator region, 1977 o Sanger – sequencing by chain termination; 5386 bp genome of ΨX174 phage, 1977 encodes 11 proteins and some guesses regarding regulatory sequences o Gilbert and Sanger shared the Nobel Prize for Chemistry (with Paul Berg) in 1980  Phage λ: 48,490 bp and encodes ~44 proteins – Sanger 1982  Automated Sanger sequencing (fluorescence based) – PE Applied Biosystems – 1993  Haemophilus influenza: 1,830,140 bp – 1995 by TIGR (Craig Venter)  Drosophila melanogaster: 139,500,000 bp – Celera – 2000  Homo sapiens: 3,000,000,000 bp TIGR and others – 2003  2005 – founding of 454 Life Sciences and the birth of “Next Generation” sequencing 3  10 beads x 300 nt/bead = 30,000,000,000 nt from a single plate  If you want 100x ‘coverage’ how many plates do you need? Manual Sanger Sequencing 454 Automated Pyrosequencing Phage ΨX174: 5386 bp 60,000/plate Can you do anything useful with nucleic acids? Phage λ: 48,490 bp 6,000/plate Haemophilus Influenza: 1,830,140 bp 150/plate Drosophila Melanogaster: 139,5000,000 bp 2/plate Homo Sapiens: 3,000,000,000 bp 10 plates Can you do anything useful with nucleic acids? Two things to worry about 1. Clinical resistUS, Department of Energy 2. We’re going to run out of oil What killed us then, what kills us now? 2 Biochem 2B03 Jasmyn Lee  Major cause of death = infectious disease including bacterial and viral pathogens o Solved by antibiotics and vaccines  Advance of antibiotic resistance will soon undo a great deal of this progress: o 90% of Staphylococcus infections are MRSA o 30% of Enterococcus infections are VRE o New Klebsiella outbreak in NYC survival rate < 50%  Antibiotic discovery – ended with the 20 century o This is a problem given the growing trend toward antibiotic resistance Engineering bacteria to make new molecules (Nodwell lab) – Michael Hart  Nucleotides o Biological molecules that possess a heterocyclic nitrogenous base, a five-carbon sugar (pentose) and phosphate as principal components of their structure o Participate as essential intermediates in virtually all aspects of cellular metabolism  Nucleic Acids – elements of heredity and the agents of genetic information transfer o Linear polymers of nucleotides o Orderly sequence of nucleotide residues in a nucleic acid can encode information o Deoxyribonucleic Acid (DNA)  Pentose (5-C sugar) is 2-deoxyribose  Repository of genetic information in cells o Ribonucleic Acid (RNA)  Pentose (5-C sugar) is ribose  Serves in the expression of information through the processes of transcription and translation  Some viruses have their genetic information stored as RNA 3 Biochem 2B03 Jasmyn Lee 10.1 What Are The Structure and Chemistry of Nitrogenous Bases?  The bases of nucleotides and nucleic acids are derivatives of either pyrimidine or purine  Pyrimidine’s (py) – 6-membered heterocyclic aromatic rings containing 2 nitrogen atoms o Planar system o Relatively insoluble in water 1. Cytosine (DNA, RNA) 2. Uracil (RNA) 3. Thymine (DNA)  Purines (Pu) o Has slight pucker between two rings o Relatively insoluble in water 1. Adenine (DNA, RNA) 2. Guanine (DNA, RNA) *root names underlined 10.2 What Are Nucleosides? Chemical Structures of Nucleosides  Nucleosides – bases linked to a sugar via a glycosidic bond o The sugars are pentose’s  D-ribose (in RNA)  2-deoxy-D-ribose (in DNA)  The difference – 2’-OH vs. 2’ H – affects secondary structure and stability  Sugars occur in linear and cyclic (furanose) forms)  To form nucleoside – base is attached to C1  Glycosidic Bond – always of the β-configuration  Named by adding –idine or –osine to the root name 4 Biochem 2B03 Jasmyn Lee 10.3 What Are the Structure and Chemistry of Nucleotides? Nucleotides are nucleoside phosphates  Nucleotide – results when phosphoric acid is esterified to a sugar –OH group of a nucleoside  Nucleoside 5’-triphosphates o Carriers of energy o Precursors of RNA and DNA  Cyclic nucleotides are signal molecules 10.4 What Are Nucleic Acids?  Nucleic Acids – polynucleotides linked 3’ to 5’ by phosphodiester  Two classes: Ribonucleic acid (RNA) and deoxyribonucleic acid (DNA)  Sequence is always read 5’ to 3’ – formed as 5’-nucleoside monophosphates and are successively added to the 3’-OH group of the preceding nucleotide 5’ end 5’ end 3’, 5’- 3’, 5’- phosphodiester phosphodiesters linkages betw[en linkages betw[en nucleotides nucleotides 3’ end 3’ end 5 Biochem 2B03 Jasmyn Lee 10.5 What Are the Different Classes of Nucleic Acids?  Information to make all the functional macromolecules of the cell is preserved in DNA and accessed through transcription of the information into RNA copies  DNA – one type, one purpose: chromosomes  RNA – many types for many purposes o Ribosomal RNA – structure and function of ribosomes o Messenger RNA – carries the message for protein synthesis o Transfer RNA – carries the amino acids for protein synthesis o Others:  Small nuclear RNA – splicing factors (removal of introns)  Small non-coding RNA’s – various regulatory functions The Fundamental Structure of DNA – Double Helix  Watson and Crick o Antiparallel double helix  Erwin Chargaff o Watson and Crick structure rested on Chargaff’s rules o Rule 1 – in any DNA molecule there are equal amounts of A/T and G/C = 1  [A] = [T]  [G] = [C] o Rule 2 – [A+T] / [G+C] varies with species  Rosalind Franklin o Used fiber diffraction with X-rays to show that DNA was helical – almost certainly a double helix  Watson and Crick o Major breakthrough was the discovery of “base pairing”  Base Pairing – bases in one strand are paired with complementary bases in the other strand  Two strands of deoxyribonucleic acid are held together by the bonding interactions between unique base pairs – always consists of a purine and a pyrimidine o If Chargaff was right there must be a stable and probably repeated interaction of A with T and G with C  A pairs with T  G pairs with C o Watson figured out a way this could happen and together Watson and Crick modeled the base pairs into a double helix  Strands held together by hydrogen bonds between bases 6 Biochem 2B03 Jasmyn Lee  DNA contains two kinds of information 1. The base sequences of genes that encode the amino acid sequences of proteins and the nucleotide sequences of functional RNA molecules such as rRNA and tRNA 2. The gene regulatory networks that control the expression of protein-encoding (and functional RNA- encoding) genes  DNA is in the form of enormously long, threadlike molecules o DNA size can be represented in terms of the number of base pairs  DNA in cells occurs in the form of chromosomes o DNA occurs in different forms in various cells o Prokaryotes – single chromosome; typically circular, proteins are associated but not uniformly organized o Eukaryotes – DNA molecules are linear and richly adorned with proteins o Histones – a class or arginine- and lysine-rich basic proteins; interact ionically with the anionic phosphate groups in the DNA backbone to form
More Less

Related notes for BIOCHEM 2B03

Log In


OR

Join OneClass

Access over 10 million pages of study
documents for 1.3 million courses.

Sign up

Join to view


OR

By registering, I agree to the Terms and Privacy Policies
Already have an account?
Just a few more details

So we can recommend you notes for your school.

Reset Password

Please enter below the email address you registered with and we will send you a link to reset your password.

Add your courses

Get notes from the top students in your class.


Submit