BIOCHEM 2B03 Chapter Notes - Chapter 10: Glycoside Hydrolase, Transfer Rna, Small Nucleolar Rna

102 views13 pages

blackgnat608

6 Sep 2013

School

Department

Course

Professor

For unlimited access to Textbook Notes, a Class+ subscription is required.

Document Summary

Making 650 return trips from earth to sun. And there"s quite a lot of them around. Number of base pairs in a human cell. Average molecular weight of a base pair 660 daltons. Earth to sun distance = 1. 5 x 10. 24 g (1 dalton = x 6. 57 x 10. We learn about dna by determining its sequence. 1970-77; competition between walter gilbert (harvard) and frederick sanger (cambridge: gilbert chemical sequencing; 24 bp lac operator, 1973. 5"tggaattgtgagcggataacaatt3 : sanger sequencing with oligos and dna polymerase i; 50 bp of phage fl, 1973. Phage : 48,490 bp and encodes ~44 proteins sanger 1982. Automated sanger sequencing (fluorescence based) pe applied biosystems 1993. Haemophilus influenza: 1,830,140 bp 1995 by tigr (craig venter) Drosophila melanogaster: 139,500,000 bp celera 2000. Homo sapiens: 3,000,000,000 bp tigr and others 2003. 2005 founding of 454 life sciences and the birth of next generation sequencing. 103 beads x 300 nt/bead = 30,000,000,000 nt from a single plate.

Related Questions

Question 1

1 pts

Cystic fibrosis is caused by nonsense and missense mutations in the CFTR gene, which encodes for a chloride channel. You are studying cystic fibrosis patients to determine what mutation they possess in the CFTR gene. The difference between the mutant and wild type CFTR genes can be uncovered by examining the CFTR:

	DNA
	mRNA
	protein
	tRNA

Question 2

1 pts

You decide to identify the CFTR mutation by analyzing the genomic DNA of your patients compared to healthy individuals. You specifically are looking to see whether a specific 3' gene truncation has occurred in the patients. You will determine this using hybridization techniques with samples from healthy and CF patients. Which of the following will allow you to accomplish this?

	Using an RNA probe complementary to the region not removed by the truncation.
	Using an RNA probe complementary to the region removed by the truncation.
	Using an DNA probe complementary to the region not removed by the truncation.
	Using an DNA probe complementary to the region removed by the truncation.

Question 3

1 pts

You would like to ensure that this experiment (to determine whether patients have a specific CFTR gene truncation using hybridization) is properly controlled. Which of the following samples must you test?

	The genomic DNA of a healthy individual who does not have cystic fibrosis.
	The genome of a CFTR patient known to have the specific truncation you are trying to identify.
	The genome of a CFTR patient with a missense mutation but full length gene.
	The genome of a healthy individual married to a CFTR patient with the specific truncation you are trying to identify.
	The genome of a patient with muscular dystrophy, which can be due to a trucation in the dystrophin gene.

Question 4

1 pts

To conduct the hybridization experiment, you are trying to decide between using a DNA or RNA probe. Which would be ideal to use and why?

	As both are composed of nucleic acids, using either would result in identical results.
	An RNA probe because RNA has uracil bases.
	An RNA probe because it could also be used in a translation experiment.
	A DNA probe because it is more stable than RNA.
	A DNA probe because RNA cannot bind to DNA.

Question 5

1 pts

Which of the following will lower the Tm of a given DNA strand?

	Increasing the percentage of GC base pairs.
	Raising the pH of the solution from neutral to basic.
	Decreasing the buffer concentration from 50mM NaCl to 5mM NaCl.
	None of the above.

Question 6

1 pts

One step of the Hershey/Chase experiment involved blending the virus/cell mixture before centrifugation and probing the pellet for radioactivity. Why was the blending step necessary?

	To collect the bacteria at the bottom of the tube.
	To break open the bacteria to release the genome.
	To separate the bacteria from the bacteriophages.
	To be able to detect the radioactivity.

Question 7

1 pts

Imagine Hershey/Chase had used an RNA virus (genome composed of RNA) instead of a DNA virus in their experiment. Would radioactivity still have been found in the pellet?

	No, because only DNA can be labeled with radioactivity.
	No, because the RNA genome would not enter the bacteria upon infection.
	No, because while DNA and RNA nucleotides are similar, they are not identical.
	Yes, because DNA and RNA nucleotides are similar.
	Yes, because genome in any form (DNA, RNA, protein) would be labeled similarly.

Question 8

1 pts

Griffith and Avery's transformation experiments allowed us to identify that DNA is our genetic information. Which of the following scenarios would result in bacterial cells that are capable of killing mice upon injection?

	Heat killed non-virulent bacteria is added to a live virulent bacteria strain.
	Heat killed virulent bacteria is added to a heat killed non-virulent bacteria strain.
	A heat killed virulent bacteria that is treated with a nuclease, is then added to a non-virulent bacteria strain.
	Heat killed mouse cells are added to a non-virulent bacteria.

Question 9

1 pts

The human genome consists mostly of non-coding DNA. Which of the following are benefits of this?

	Random DNA mutations generally won't affect RNA and protein function.
	It is faster to duplicate the genome when these are present.
	The existence of introns can lead to multiple variations of proteins encoded by a single gene.
	It is unlikely transposons would exist in the genome if there was too much protein coding DNA.

Question 10

1 pts

Andrew Murray's sister, Andrea, is adding to her brother's work on chromosomes. She is using cells that are unable to synthesize adenine (âade) and histidine (âhis). The plasmid she is currently working with consists of an origin of replication and the Ade gene.

Following her transformation of the plasmid into her yeast, what media will the cells be plated on to select for cells that have picked up the plasmid?

	Media containing histidine
	Media containing adenine
	Media lacking adenine
	Media lacking histidine

tealcockroach755

Biochemistry Review Questions

What is the classification of the compound shown here?

A) an aldohexose B) a ketohexose C) an aldopentose D) a ketopentose

2. In a disaccharide, the CâO bond that joins the two rings together is called _____.

A) a hemiacetal B) a glycosidic linkage C) an alditol D) an anomer

3. What is the structure of amylopectin?

A) unbranched skeleton of glucose molecules joined by 1ï®4-ï¡-glycoside linkages

B) branched skeleton of glucose molecules joined by 1ï®4-ï¡-glycoside linkages

C) unbranched skeleton of glucose molecules joined by 1ï®4-ï¢-glycoside linkages

D) branched skeleton of glucose molecules joined by 1ï®4-ï¢-glycoside linkages

4. In a disaccharide, the CâO bond that joins the two rings together is called _____.

A) a hemiacetal B) a glycosidic linkage C) an alditol D) an anomer

5. Which type of linkage between the two rings is in the structure shown?

A) 1Â®4-b-glycoside linkage D) 1Â®1-a-glycoside linkage

B) 1Â®4-a-glycoside linkage E) 1Â®2-b-glycoside linkage

C) 1Â®1-b-glycoside linkage

6. What is the structure of cellulose?

A) unbranched skeleton of glucose molecules joined by 1Â®4-a-glycoside linkages

B) branched skeleton of glucose molecules joined by 1Â®4-a-glycoside linkages

C) unbranched skeleton of glucose molecules joined by 1Â®4-b-glycoside linkages

D) branched skeleton of glucose molecules joined by 1Â®4-b-glycoside linkages

7. Which amino acid is a basic amino acid?

A) serine B) arginine C) cysteine D) alanine E) valine

8. What monosaccharide is found in cellulose, starch, and glycogen?

A) glucose

B) galactose

C) N-acetyl-D-glucosamine

D) fructose

E) More than one of the monosaccharides above is found in cellulose, starch, and glycogen.

9. Which is not a reducing sugar?

A) glucose B) fructose C) sucrose D) galactose E) an aldopentose

10. Sucrose contains one _____ unit and one _____ unit.

11. What is the particular sequence of amino acids of a protein that are joined together by peptide bonds called?

A) the primary structure of a protein C) the tertiary structure of a protein

B) the secondary structure of a protein D) the quaternary structure of a protein

12. What is the charge on an amino acid at a pH below its pI?

A) positive

B) neutral

C) negative

D) The charge or lack of charge varies depending on the amino acid.

13. What is the C-terminal amino acid in the tetrapeptide glycylalanyisoleucylmethionine?

A) alanine B) glycine C) methionine D) isoleucine

14. How many different dipeptides can be formed when one valine reacts with one glycine?

A) 1 B) 2 C) 3 D) 4

15. What is the process of altering the shape of a protein without breaking the amide bonds that form the primary structure?

A) hydrolysis B) competitive inhibition C) denaturation D) oxidation

16. Which of the following compounds is an enzyme?

A) glucose C) N-acetyl-D-glucosamine

B) triosephosphate isomerase D) dihydrofolate

17. What is a zymogen?

A) an amino acid with a neutral charge

B) inactive precursor of an enzyme

C) a molecule that causes an enzyme to lose activity

D) a nonprotein organic molecule needed for an enzyme-catalyzed reaction to occur

18. Which of the following will the cause the rate of enzyme activity to first increase and then level off?

increasing the enzyme concentration

increasing the temperature

increasing the substrate concentration

increasing the pH

19. Which of the following make up a nucleoside?

base + sugar

base + phosphate + sugar

base + phosphate

phosphate + sugar

20. Transcription corresponds to which of the following?

the separation of the two strands of DNA to enable the formation of two identical DNA molecules

the transfer of genetic information from DNA to RNA

the transfer of genetic information from RNA to DNA

the use of genetic information to synthesize a specific protein

21. Each individual tRNA contains _____

A) a base sequence that is identical to the informational strand of DNA.

B) the sequence of codons that determines the order of amino acids in the protein.

C) an anticodon of three nucleotides that is complementary to the codon in mRNA and identifies individual amino acids.

D) an anticodon complementary to any of the three stop codons.

22. Where does energy production occur in animal cells?

A) cell membrane B) cytoplasm C) mitochondria D) nucleus

23. How many molecules of CO2 are produced for each turn of the citric acid cycle?

A) 0 B) 1 C) 2 D) 3 E) 4

25. Which is not a reaction found in stage [2] of catabolism?

A) fatty acid oxidation C) oxidative phosphorylation

B) glycolysis D) amino acid catabolism

26. What is the classification of the reaction shown?

A) oxidation D) hydrolysis

B) reduction E) isomerization

C) decarboxylation

27. Synthesis of glucose from amino acids is called

A) Glycolysis C) Gluconeogensis

B) Glycogenesis D) Hydrolysis

28. The synthesis of large molecules from smaller ones in the body is referred to as

A) catabolism C) Ketogenesis

B) anabolism D)glycolysis

29. The nucleic acid base found in the mRNA but not in DNA is

A) Adenine C) Uracil

B) Guanine D) Cytosine

30. DNA rich in A-T base pairs have

A) 1 hydrogen bond C) 2 hydrogen bonds

B) 3 hydrogen bonds D) 4 hydrogen bonds

31. Where does the energy production occur in the cell?

A) Ribosome C) Mitochondria

B) Nucleus D) Cytoplasm

32. Where does the protein synthesis occur in the cell?

A) Ribosome C) Mitochondria

B) Nucleus D) Cytoplasm

33. In the process of transcription, the flow of genetic information is from

A) DNA to DNA C) DNA to protein

B) RNA to protein D) DNA to RNA

34. Ammonium ions are converted to non-toxic nitrogen containing compounds through

A) Amino acid metabolism C) Urea cycle

B) Citric acid cycle D) transamination

35. In protein structure, B-pleated cheats are examples of

A) Primary structure C) Secondary structure

B) Tertiary structure D) Quaternary structure

36. Lactose is a disaccharide formed of

A) Glucose + fructose C) Glucose + galactose

B) Glucose + glucose D) Fructose + galactose

37. Saponification is

A) Hydrolysis of fats by strong base

B) Hydrolysis of glycerol by lipases

C) Esterification

D) Oxidation reaction

38. The connection between amino acid residues in molecules of protein is

A) glycosidic linkage C) peptide linakge

C) ether linkage D) phosphodiester linkage

39. Polyunsaturated fatty acids are generally

A) Oil at room temperature C) Solid at room temperature

B) Semisolid at room temperature D) All of the above

40. Maximum energy is produced by

A) Carbohydrates C) Lipids

B) Proteins D) Nucleic acids

41. A polynucleotide contains _____

A) one free phosphate group at the 5' end.

B) a backbone of alternating sugar and base groups.

C) one free phosphate group at the 1' end.

D) one free OH group at the 5' end.

42. How many molecules of CO2 are produced for each turn of the citric acid cycle?

A) 0 B) 1 C) 2 D) 3 E) 4

43. How many molecules of GTP are produced for each turn of the citric acid cycle?

A) 0 B) 1 C) 2 D) 3 E) 4

44. Which is the enzyme that hydrolyzes triacylglycerols?

A) acetyl CoA D) lipase

B) protease pepsin E) succinate dehydrogenase

C) amylase

1. What recent research has indicated that studying Down Syndrome may hold a key to cancer growth and slowing tumor growth? In your answer be sure to mention the DSCR1 gene, angiogenesis suppression, and why individuals with Downâs Syndrome rarely have solid tumor growth. 2. Select your favorite chromosome and list the following: Three disorders that are found on this chromosome, Indicate the type of disorder (dominant, recessive) and the type of numerical or structural aberration. 3. Assume that crossing over does not occur in the region of each chromosome that is associated with the centromere. You have 46 centromeric regions in each cell, 23 that are copies of the DNA in your motherâs egg and 23 that are copies of the DNA fatherâs sperm. a. For any given gamete, what is the probability that all the centromeric regions will be copies of the same ones that you received from your mother? b. It has been estimated that the average person is heterozygous for at least 2,000 protein forming genes. How many different kinds of gametes is it theoretically possible for each person to produce? c. Considering the maternal and paternal origin of the centromeric regions alone, how many different kinds of gametes can you produce? 4. Find a current article on Telomerase (within the last year). Summarize the article and answer the following: What is telomerase? Why is it viewed as the fountain of youth? Attach the abstract or the first page. 5. Promiscuous Sun Flower has five lovers, but she has decided that the only true father of her child can have her hand in marriage. Sunâs Blood type is A- her five suitors blood types are as follows: a. Maury AB+ b. Elmer O+ c. Willie A- d. Jiggs B- e. Cousin it B+ 6. What is the epigenome. Explain why the study of the epigenome may not follow normal Mendelian genetics 7. Explain what is meant by the statement âWomen are just as hemizygous as menâ. 8. After having 10 children you remarryâ¦â¦ What is the probability of you now having a boy and then a girl, and then a girl, and then a boy, and then a boy or a girl, and then a girl? You now have 16 childrenâ¦â¦ 9. The genetic code has four codons for the amino acid Valine (GUG, GUC, GUU, GUA). Organisms have evolved to use some codes more than other codes. Which of the valine codes would you expect to be preferentially used in the genome of an algae growing in a hot spring at Yellowstone Park? EXPLAIN your answer 10. You discovered a new virus that needs to be studied. You begin by digesting the virus with protease (an enzyme that completely digests all proteins) until only amino acids remain. You then determine that the base composition of the viral nucleic acid is 38% Cytosine, 35% Glycine, 15% Thymine, and 12 % Adenine. To which class could this virus belong? EXPLAIN YOUR ANSWER a. Single-stranded RNA Virus b. Double-stranded RNA Virus c. Single-stranded DNA Virus d. Double=stranded DNA Virus e. None of the above because there is not enough information given to make a guess. 11. Adenine is found in numerous biological molecules (for example, DNA, RNA, NADH, ATP). You are now asked to explain the evolution of adenine and at least 5 of these biological (Adenine containing) molecules and how they may have evolved (the order).

amethysthippopotamus941

BIOCHEM 2B03 Chapter Notes - Chapter 10: Glycoside Hydrolase, Transfer Rna, Small Nucleolar Rna

Document Summary

Get access

Related Documents

BIOCHEM 2B03 Chapter Notes - Chapter 11: Interphase, Thymidine Triphosphate, Dna Supercoil

BIOCHEM 2B03 Lecture Notes - Lecture 3: Ribonuclease, Deoxyribonuclease, Nucleophile

BIOCHEM 2B03 Chapter Notes - Chapter 29: Rna Polymerase Iii, Ribosomal Rna, Thermophile

Related Questions