Textbook Notes (280,000)
CA (170,000)
McMaster (10,000)
BIOCHEM (70)
Chapter 10

BIOCHEM 2B03 Chapter Notes - Chapter 10: Glycoside Hydrolase, Transfer Rna, Small Nucleolar Rna


Department
Biochemistry
Course Code
BIOCHEM 2B03
Professor
Margaret Fahnestock
Chapter
10

Page:
of 13
Biochem 2B03
Jasmyn Lee
1
Chapter 10: Nucleotides and Nucleic Acids
Nucleic Acids
Very big molecules
RNA: Ribonucleic Acid
DNA: Deoxyribonucleic Acid
Really Big Molecules
Source of info
Number of cells in an adult
1014 (100 trillion)
Science Netlink
Number of base pairs in a human cell
6 x 109 (6 billion)
Human Genome Project
Average height (meters) of a base pair
0.34 x 10-9 (0.34 nanometer)
Everyone knows that...
Meters of DNA in a human cell
2.04 m
Do the math...
Meters of DNA in a human adult
2.04 x 1014(200 billion km)
See above
How impressive?
Making 650 return trips from Earth
to Sun
Earth to Sun distance = 1.5 x 1011 m
Wikipedia
20 million times across Earth
Earth diameter = 1.3 x 107 m.
Wikipedia
And there’s quite a lot of them around
Source of info
Number of cells in an adult
1014 (100 trillion)
Science Netlink
Number of base pairs in a human cell
6 x 109 (6 billion)
Human Genome Project
Average molecular weight of a base pair
660 Daltons
Textbook
Daltons of DNA in a human cell
3.96 x 1012
6 x 109 x 660 Daltons
Grams of DNA in a human cell
6.57 x 10-12 (~6 picogram)
1 Dalton = 1.66 x 10-24 g (1 Dalton =
1/NA gram)
Grams of DNA in a human adult
657.36 (~1.5 lbs)
1014 x 6.57 x 10-12
% body weight (150-lbs)
1%
We learn about DNA by determining its sequence
1970-77; Competition between Walter Gilbert (Harvard) and Frederick Sanger (Cambridge)
o Gilbert chemical sequencing; 24 bp lac operator, 1973
5'TGGAATTGTGAGCGGATAACAATT3‘
o Sanger sequencing with oligos and DNA polymerase I; 50 bp of phage fl, 1973
Biochem 2B03
Jasmyn Lee
2
5'ACCATCCAATAAATCATACAGGCAAGGCAAAGAATTAGCAAAATTAAGCAATAAAGCC3‘
o Maxam and Gilbert 100 bp of lac operator region, 1977
o Sanger sequencing by chain termination; 5386 bp genome of ΨX174 phage, 1977 encodes 11 proteins
and some guesses regarding regulatory sequences
o Gilbert and Sanger shared the Nobel Prize for Chemistry (with Paul Berg) in 1980
Phage λ: 48,490 bp and encodes ~44 proteins – Sanger 1982
Automated Sanger sequencing (fluorescence based) PE Applied Biosystems 1993
Haemophilus influenza: 1,830,140 bp 1995 by TIGR (Craig Venter)
Drosophila melanogaster: 139,500,000 bp Celera 2000
Homo sapiens: 3,000,000,000 bp TIGR and others 2003
2005 founding of 454 Life Sciences and the birth of “Next Generation” sequencing
103 beads x 300 nt/bead = 30,000,000,000 nt from a single plate
If you want 100x coverage’ how many plates do you need?
Manual Sanger Sequencing
454 Automated Pyrosequencing
Phage ΨX174: 5386 bp
60,000/plate
Phage λ: 48,490 bp
6,000/plate
Haemophilus Influenza: 1,830,140 bp
150/plate
Drosophila Melanogaster: 139,5000,000 bp
2/plate
Homo Sapiens: 3,000,000,000 bp
10 plates
Can you do anything useful with nucleic acids?
Two things to worry about
1. Clinical resistance to antibiotics
2. We’re going to run out of oil
What killed us then, what kills us now?
Biochem 2B03
Jasmyn Lee
3
Major cause of death = infectious disease including bacterial and viral pathogens
o Solved by antibiotics and vaccines
Advance of antibiotic resistance will soon undo a great deal of this progress:
o 90% of Staphylococcus infections are MRSA
o 30% of Enterococcus infections are VRE
o New Klebsiella outbreak in NYC survival rate < 50%
Antibiotic discovery ended with the 20th century
o This is a problem given the growing trend toward antibiotic resistance
Engineering bacteria to make new molecules (Nodwell lab) Michael Hart
Nucleotides
o Biological molecules that possess a heterocyclic nitrogenous base, a five-carbon sugar (pentose) and
phosphate as principal components of their structure
o Participate as essential intermediates in virtually all aspects of cellular metabolism
Nucleic Acids elements of heredity and the agents of genetic information transfer
o Linear polymers of nucleotides
o Orderly sequence of nucleotide residues in a nucleic acid can encode information
o Deoxyribonucleic Acid (DNA)
Pentose (5-C sugar) is 2-deoxyribose
Repository of genetic information in cells
o Ribonucleic Acid (RNA)
Pentose (5-C sugar) is ribose
Serves in the expression of information through the processes of transcription and translation
Some viruses have their genetic information stored as RNA