BIOL 2030 Lecture Notes - Lecture 9: Rna Polymerase Iii, Hormone Response Element, Transfer Rna

29 views2 pages

salmonrat522

12 Apr 2016

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Can regulate at the level of the gene or the chromosome domain. Transcripion and translaion are separated which means that it can be regulated at many diferent places. Many eukaryotes are mulicellular which means that genes can be regulated from diferent cells. Alternate splicing of exons: diferent mechanisms can determine the splicing of exons, the signal can come from diferent cell s. Muliple 3 cleavage sites: diferent sites to cleave at the end of a sequence. Faster transport means that it gets translated faster. Produced and then stored for a certain developmental stage mrna degradaion. Faster degradaion means that the levels of that protein will go down in the cell. Can be controlled as to whether or not it happens or how fast it happens. Diferent chemicals can be added to determine the funcion of the protein. How quickly the protein is broken down. Whether or not it is targeted for degradaion.

Related Questions

Eukaryotic transcription normally takes place on a chromatin template at nuclease-accessible sites.(True/False)

*After promoter clearance by RNA polymerase II:

A) all associated factors remain bound to the polymerase for elongation.

B) a subset of factors remain at the promoter region.

*Which of the following statements is FALSE?

A) RNA polymerase II is responsible for the transcription of genes encoding protein-coding sequences only.

B) Many promoters recognized by RNA polymerase II contain regulatory elements several kbp upstream of the initiation site.

C) TFIIB has a role in converting a closed-promoter into an open-promoter complex.

D) The C-terminal domain of the largest subunit of RNA pol II undergoes extensive phosphorylation prior to transcription elongation.

E) A multiprotein complex is involved in communication between upstream control elements and proteins bound at the promoter.

C) no further elongation factors are acquired by the polymerase.

D) no further chromatin remodeling is required.

E) transcription continues until the polymerase reaches the poly (A) tail

*In eukaryotes RNA polymerase I transcribes all of the ribosomal RNA components.(TRUE/FALSE)

1 DNA sequences found in introns provide [A] amino acid sequence information.

[B] regulatory information.
[C] no known useful information.

[D] structure for the gene.
[E] alternative DNA splicing possibilities.

3. The TATA box is a(n)
[A] sequence close to the promoter region of many genes.
[B] square-shaped sequence.
[C] enhancer consensus sequence.
[D] activator sequence necessary for proper translation.
[E] None of the above

5. Regarding genes and gene expression, which of the following is not a difference between prokaryotes and eukaryotes
[A] Eukaryotic DNA does not contain a TATA box close to the initiation site as does prokaryotic DNA.

[B] In eukaryotes, RNA polymerase requires

'transcription factors'or initiation.

[C] Prokaryotic genes are often grouped together in

operons.

[D] In eukaryotes, the regulation of several genes at once requires common control elements in each of the genes.
[E] There is a diversity of eukaryotic polymerases that is reflected in the diversity of eukaryotic promoters.

10) In eukaryotic cells, a repressor

[A] is made of DNA.
[B] binds to the enhancer region to block transcription. [

C] is located both upstream and downstream from the promoter.
[D] binds to the operator to block RNA polymerase.

[E] binds to a silencer to reduce transcription rates.

Coordinated regulation of genes in eukaryotic cells [A] is the result of positioning the same regulatory sequence in front of each gene.
[B] results from all of those genes being under the control of one promoter.

[C] occurs because related genes all have the same

operons.
[D] occurs because enhancers cause DNA to bend.

You have discovered a new gene âXâ that appears to be regulated by 3 transcription factors (E2F, SP-1 and C/EBPa). Another gene âYâ appears to also be regulated by these same proteins. Both genes are involved in cell cycle initiation but gene Y is expressed later in the cell cycle than gene X.

The DNA sequence at the promoter region is GCGCCAATGTGCTGACAGTTAATTAGGGCTA

The known DNA consensus sequence for each Transcription Factor is:

E2F â GCCAATGTGCTGA

SP-1 â GCTGACAGTTAA

C/EBPa â ACAGTTAATTAGG

It is not known which protein(s) are binding to their respective DNA consensus sequences. It is possible for one protein to be interacting with one another and not directly to the DNA. It is also possible for a transcription factor to use all or only a majority of the DNA consensus sequence. Both scenarios are possible. Discuss in general how protein:DNA and potein:protein interactions occur at the molecular level. Propose an explanation for what you believe may be happening and then design a series of experiments that will investigate the regulation of Gene X and Gene Y. All proteins and gene sequences are known. You have a large well-funded lab.

BIOL 2030 Lecture Notes - Lecture 9: Rna Polymerase Iii, Hormone Response Element, Transfer Rna

Document Summary

Get access

Related Documents

BIOL 2030 Lecture Notes - Lecture 25: Hormone Response Element, Rna Polymerase Iii, Rna Polymerase Ii

BIOL 2030 Lecture Notes - Lecture 6: Cistron, Operon, Prokaryote

BIOL 2030 Lecture Notes - Lecture 31: Ribosomal Rna, Prokaryote, Gene Expression

Related Questions