BIO 1140 Lecture 17: BIO 1140 lectures 16-17

64 views6 pages

olivefox459

24 Aug 2016

School

University of Ottawa

Department

Biology

Course

BIO 1140

Professor

Caroline Petit- Turcotte

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Going to read each nucleotide 3 at a time and each codon is something different. Code is the available words that you can use to make the sentence that the rna is trying to say. To minimize mistakes, there are no two codons that mean the same thing, no ambiguity. Can use more than 1 codon for the same amino acid but no codon codes for 2 amino acids. All mrna will start with aug, the start codon. Don"t correspond to any amino acid but signal that the ribosome has come to the end of the code. Using the codon table, determine the sequence of amino acids obtained with the following mrna 5" auggguuauagcaccacuuga 3". When the trna brings the amino acid to the ribosome there is flexibility the first 2 nucleotides must be absolute and the difference lies in the 3rd.

Related Questions

Fill in the blank. Elongation during translation does NOT involve ____________.

Question 16 options:

	the translation of codons according to the genetic code
	the formation of bonds catalyzed by the ribosome
	complementary base pairing between RNA molecules
	amino acids being linked together in a polypeptide
	reading the DNA template 3' to 5'

For a given gene, what establishes the reading frame for translation?

Question 17 options:

	the location of the enhancer relative to the gene
	the first three nucleotides at the 5' end of the mRNA
	the first three nucleotides at the 3' end of the mRNA
	the start codon in the mRNA
	the location of the promoter relative to the gene

Which of the following is the LEAST likely direct consequence of a substitution mutation?

Question 18 options:

	changing the length of a protein coded for by a gene
	changing one amino acid in a protein
	creating a stop codon
	eliminating a start codon
	changing the length of the DNA molecule containing a gene

Suppose that the pre-mRNA transcript from a eukaryotic gene is 30,000 nucleotides long, and the gene codes for a sequence of 300 amino acids. What is the best explanation for the relationship between these numbers?

Question 19 options:

	only the first 900 nucleotides of the pre-mRNA transcript are translated
	it takes 100 nucleotides to specify a single amino acid
	300 of the nucleotides in the transcript are important, and the rest are "junk"
	only the last 900 nucleotides of the pre-mRNA transcript are translated
	large portions of pre-mRNA transcripts are cut out during RNA processing

Suppose an individual is born into a population with a novel mutation. Is the new mutation an evolutionary change, and why?

Question 20 options:

	no, because it is not a big enough change to count
	yes, because new mutations are always adaptive
	yes, because the appearance of a new genetic variant is a genetic change in a population
	no, because not enough individuals have the mutation for it to matter
	no, because most mutations are not adaptive

1. The four nucleotides found in human DNA (G, A, T, C) combinein groups of three to create potentially 64 different amino acids,but only 20 amino acids, one start codon and three stop codons areused to construct proteins. Why is this so?

a.Many amino acids are not considered complete until they bindwith a second amino acid.
b.64 amino acids are produced, but the body only integrates
c.42 of them into proteins. 64 amino acids are initially produced,but 42 of them are unstable and degrade immediately. Differentd.nucleotide combinations code for the same amino acid.

2.What term is used to describe the phenomenon that there are 64different groups of 3 nucleotides to code for amino acids but only20 amino acids, 1 start codon, and 3 stop codon used in proteinconstruction.

a.Crossing over
b.Redundancy
c.DNA structure
d.Transcription

Suppose a male and a female with chromosomes "DD" (male) and"dd" (female) crossbreed. How likely is their offspring to exhibitthe DD genotype?

100%
25%
50%
0%

4.What term best describes the genotype of "dd"?
a.heterozygous
b.monohybrid
c.homozygous
d.haploid

5.Suppose a male and a female with chromosomes "DDBb" (male) and"ddBB" (female) interbreed. How likely is their offpsring toexhibit the DdBb genotype? 100% 50% 25% 0%?

6. What term best describes the breeding perfomed when a maleand female with chromosomes "DDBb" (male) and "ddBB" (female)interbreed?

Dihybrid cross

Codominance

Incomplete dominance

Monohybrid cross

tealgoat796

1. _________________________ is the name of the process that produces proteins using RNA molecules.

a.Transcription

b Translation

c. Replication

d. Mutagenesis

2. The peptide bonding site on the ribosome:

a. A site

b. P site

c. E site

d. D site

3. The name given to the bond formed between two amino acids.

a. Hydrogen bond

b. Double bond

c. Peptide bond

d. Negative bond

4. __________________________ is the movement of the mRNA molecule on the ribosome to open up the A-site for the new incoming amino acid.

a. Transformation

b. Mutation

c. Translocation

d. Initiation

5. What does the term semi-conservative mean.

a. Replication of RNA is semi-conservative, each new strand consists of one old strand of RNA and one new strand of RNA.

b. Replication of DNA is semi-conservative, each new strand consists of one old strand of DNA and one new strand of DNA.

c. Replication of DNA is semi-conservative, each new strand consists of new strands of nucleotides.

d. Transcription of RNA is semi conservative.

6. This molecule functions during protein synthesis to recognize the codon and bring the proper amino acid back to the ribosome for translation.

a. mRNA

b. tRNA

c. rRNA

d. DNA polymerase

7. What is meant by the base-pairing rule.

a. Bases on a single strand of DNA are always found as pairs

b. Adenine always base pairs with guanine; cytosine with thymine

c. Adenine always base pairs with thymine; cytosine with guanine

d. Bases on a single strand of RNA are found in pair.

8. In this step of protein synthesis, amino acids are added to a growing polypeptide chain.

a. Initiation.

b. Elongation.

c. Termination.

d. Transpiration.

9. Three complementary bases found in a mRNA are called ____________________.

a. Anti-codon.

b. Triplet.

c. Doublet.

d. Codons.

10. Which statement best describes the job or function of the messenger RNA.

a. Carries the map of the gene sequence in the form of codons to the cytoplasm

for translation of the protein.

b. It transfers amino acids to the ribosome for protein synthesis.

c. It forms the ribosomes.

d. It helps replicate DNA.

ceruleangnat663

BIO 1140 Lecture 17: BIO 1140 lectures 16-17

Document Summary

Get access

Related textbook solutions

Molecular Cell Biology

Biology: Science for Life with Physiology

Biology

Concepts of Biology

Essentials of Biology

Related Documents

BIO 1140 Study Guide - Final Guide: Actomyosin Ring, Topoisomerase, Uracil

BIO 1140 Lecture Notes - Lecture 16: Inosine, Methionine, Polysome

BIO 1140 Lecture Notes - Lecture 10: Signal Recognition Particle, Base Pair, Transferase

Related Questions