BIOL 101 Lecture Notes - Lecture 35: Alanine, Hemoglobin, Immunodeficiency
Document Summary
Get access
Related Documents
Related Questions
Fill in the blank. Elongation during translation does NOT involve ____________.
Question 16 options:
| the translation of codons according to the genetic code | |
| the formation of bonds catalyzed by the ribosome | |
| complementary base pairing between RNA molecules | |
| amino acids being linked together in a polypeptide | |
| reading the DNA template 3' to 5' |
For a given gene, what establishes the reading frame for translation?
Question 17 options:
| the location of the enhancer relative to the gene | |
| the first three nucleotides at the 5' end of the mRNA | |
| the first three nucleotides at the 3' end of the mRNA | |
| the start codon in the mRNA | |
| the location of the promoter relative to the gene |
Which of the following is the LEAST likely direct consequence of a substitution mutation?
Question 18 options:
| changing the length of a protein coded for by a gene | |
| changing one amino acid in a protein | |
| creating a stop codon | |
| eliminating a start codon | |
| changing the length of the DNA molecule containing a gene |
Suppose that the pre-mRNA transcript from a eukaryotic gene is 30,000 nucleotides long, and the gene codes for a sequence of 300 amino acids. What is the best explanation for the relationship between these numbers?
Question 19 options:
| only the first 900 nucleotides of the pre-mRNA transcript are translated | |
| it takes 100 nucleotides to specify a single amino acid | |
| 300 of the nucleotides in the transcript are important, and the rest are "junk" | |
| only the last 900 nucleotides of the pre-mRNA transcript are translated | |
| large portions of pre-mRNA transcripts are cut out during RNA processing |
Suppose an individual is born into a population with a novel mutation. Is the new mutation an evolutionary change, and why?
Question 20 options:
| no, because it is not a big enough change to count | |
| yes, because new mutations are always adaptive | |
| yes, because the appearance of a new genetic variant is a genetic change in a population | |
| no, because not enough individuals have the mutation for it to matter | |
| no, because most mutations are not adaptive |
Question 4
Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)
| Guanine histone Double helix Adenine conservative cytosine | Okazaki fragments Thymine introns Leading strand RNA polymerase 5-prime to 3-prime | Uracil chromatin DNA ligase Semi-conservative promoter | Lagging strand DNA polymerase nucleosomes Electron transport chain enhancer |
Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.
Question 5
In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."
| Lactose | Glucose | Lac expression? |
| No | Yes | |
| Yes | Yes | |
| Yes | No |
Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.
Question 6
Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)
a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:
5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â
b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.
c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?
