a. Which DNA mutation is more likely to have a detrimental effect on the protein it codes for: a 1 base pair deletion from the middle of the coding sequence of a gene, or a 9-base pair deletion from the same region of the gene? Explain why?

b. Would the outcome be different if the deletions happened within the geneâs intron? Explain why?

answer

watching

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Tod ThielLv2

7 Oct 2018

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

Related questions

Consider each of the pairs of mutational events and decide which of each pair would likely have the greatest effect on an organism. Describe the effect of each and indicating which would have the greatest effect and your reasoning.

A) Substitution in the first nucleotide of a codon OR substitution in the third nucleotide of a codon

B) Deletion of six nucleotides in the coding region OR deletion of two nucleotides in the coding

region

C) Mutation in the intron of a gene OR mutation in the promoter of a gene

D) Name one other location (not mentioned above) that a mutation could occur that could affect

the protein product and explain how the mutation would have an effect.

Below is a partial mRNA sequence. Use it to answer the following questions.

5 - UGGUCGGCGAGAACGAAAGCGC - 3

The amino acids in the original partial sequence (N-term-...V-G-E-N-E-S...-C-term) have little to no impact on protein structure and function, with the exception of serine. Phosphorylation of the serine residue is required for normal function of the protein.

Given this information, which reversion mutation(s) in the gene would restore the normal function of the entire protein?
Select the four correct answers.

Deletion of 1 base-pair in the region of the valine codon
Insertion of 1 base-pair in the region of the valine codon
Deletion of 2 base-pairs in the region of the valine codon
Deletion of 5 base-pairs in the region of the valine codon
Insertion of 2 base-pairs in the region of the valine codon
Insertion of 4 base-pairs in the region of the valine codon

beigeyak805

1a. which is likely to be more deleterious, a 1bp deletion from an exon in the coding sequence of a gene, or a 3 bp deletion? Explain clearly what all the potential consequences of both deletions could be on the proteins amino acid sequence.

1b. how many different 9-nucleotide mRNA sequences could you make that would produce the peptide tyrosine-leucine-arginine? Assume you are using a cell-free system that does not require a START codon.

1c. imagine you have a single nucleotide substitution (an A has mutated to a G, for example) in an exon of a gene's coding region. It reduces the activity of that gene's protein in your cells to 50% of the usual level of activity. Imagine also that you have a single nucleotide substitution in the same gene's promoter region, and this mutation also reduces the activity of that gene's protein in your cells to 50% of the usual level of activity. Do the 2 mutations reduce the proteins activity level via the same mechanism? Explain your answer.