1. (a) What is the structural differencebetween all deoxyribonucleotides and all ribonucleotides and whydoes this make DNA more appropriate to act as the genetic materialthan RNA. (4 points)
(b) Why is uracil replaced by thymine in DNA? (4 points)
(c) Can ribonucleotides base-pair with a deoxyriboncleotides andif so when does this happen? (4 points)
(d) The two strands in DNA are antiparallel. What does thismean? (4 points)
(e) Why are they antiparallel? (4 points)
2. A single stranded DNA molecule has thefollowing sequence: 5'-GGTTAGGTTAGGTTAGGTTA-3'
(a) To fully replicate this molecule, what is the sequence ofthe primer that must be synthesized by the primase enzyme (assume aprimer length of 5 bp). (Here and below write how you wouldconventionally write a single stranded DNA sequence, i.e. withoutthe template.) (4 points)
(b) When fully replicated, what is the sequence of the newlysynthesized DNA strand? (4 points)
(c) What is the sequence of the molecule synthesized in theabsence of DNA pol I? (4 points)
(d) What is the sequence of what would be synthesized in theabsence of DNA ligase? (4 points)
(e) What is the total number of H-bonds that are formed duringthe synthesis of the DNA strand (from the very beginning)? (4points)
3. Different temperature sensitive mutants ofE. coli in genes encoding proteins involved in replication weregrown at the permissive temperature for several generations andwhile still actively growing the temperature was raised to therestrictive temperature. After raising temperature, the synthesisof new DNA was assessed using radioactively labeled nucleotides.Assume the mutations completely inactivate the proteins at therestrictive temperature and that function of the mutant protein wasabolished instantly temperature was raised. Would any new DNA bedetected in the following mutants after raising thetemperature?
(4 points each) (a) DnaA
(b) DNA helicase
(c) DNA primase
(d) DNA pol I
(e) DNA pol III
1. (a) What is the structural differencebetween all deoxyribonucleotides and all ribonucleotides and whydoes this make DNA more appropriate to act as the genetic materialthan RNA. (4 points)
(b) Why is uracil replaced by thymine in DNA? (4 points)
(c) Can ribonucleotides base-pair with a deoxyriboncleotides andif so when does this happen? (4 points)
(d) The two strands in DNA are antiparallel. What does thismean? (4 points)
(e) Why are they antiparallel? (4 points)
2. A single stranded DNA molecule has thefollowing sequence: 5'-GGTTAGGTTAGGTTAGGTTA-3'
(a) To fully replicate this molecule, what is the sequence ofthe primer that must be synthesized by the primase enzyme (assume aprimer length of 5 bp). (Here and below write how you wouldconventionally write a single stranded DNA sequence, i.e. withoutthe template.) (4 points)
(b) When fully replicated, what is the sequence of the newlysynthesized DNA strand? (4 points)
(c) What is the sequence of the molecule synthesized in theabsence of DNA pol I? (4 points)
(d) What is the sequence of what would be synthesized in theabsence of DNA ligase? (4 points)
(e) What is the total number of H-bonds that are formed duringthe synthesis of the DNA strand (from the very beginning)? (4points)
3. Different temperature sensitive mutants ofE. coli in genes encoding proteins involved in replication weregrown at the permissive temperature for several generations andwhile still actively growing the temperature was raised to therestrictive temperature. After raising temperature, the synthesisof new DNA was assessed using radioactively labeled nucleotides.Assume the mutations completely inactivate the proteins at therestrictive temperature and that function of the mutant protein wasabolished instantly temperature was raised. Would any new DNA bedetected in the following mutants after raising thetemperature?
(4 points each) (a) DnaA
(b) DNA helicase
(c) DNA primase
(d) DNA pol I
(e) DNA pol III
For unlimited access to Homework Help, a Homework+ subscription is required.
Related textbook solutions
Related questions
1. | In addition to identifying the genetic material, the experiments of Avery, MacLeod, and McCarty with different strains of Streptococcus pneumoniae demonstrated that | ||||||||||
|
2. | In order to show that DNA in cell extracts is responsible for genetic transformation in Streptococcus pneumoniae, important corroborating evidence should indicate that _______ also destroy transforming activity. | ||||||||||
|
3. | Based on what you have learned about the experiments conducted by Griffith and Avery and colleagues with bacteria, which of the following would result in transformation of living R cells? | ||||||||||
|
4. | A-T base pairs in a DNA double helix | ||||||||||
|
5. | If 23 percent of the bases in a sample of double-stranded DNA are adenine, what percentage of the bases are uracil? | ||||||||||
|
6. | The uniform diameter of the DNA structure provides evidence for | ||||||||||
|
7. | If a sequence of one strand of DNA is 5â²-TGACTATC-3â², what is the complementary strand? | ||||||||||
|
8. | What structural aspect of the DNA facilitates dissociation of the two DNA strands for replication? | ||||||||||
|
9. | If the MeselsonâStahl density gradient experiment had resulted in two bands of DNA molecules after only one round of replication, one containing only 15N and the second only 14N, this result would have indicated that replication was | ||||||||||
|
10. | The nucleoside analogue acyclovir, which is used to treat herpes simplex virus (HSV) infections, lacks a 3â² hydroxyl group (âOH). Predict what will happen if the host cell DNA polymerase incorporates a molecule of acyclovir into an elongating strand of HSV DNA. | ||||||||||
|
11. | Which of the following does not demonstrate the stability of the DNA double helix? | ||||||||||
|
12. | What effect would a primase inhibitor have on DNA replication? | ||||||||||
|
13. | To replicate their DNA in a timely manner, most eukaryotic chromosomes | ||||||||||
|
14. | Which statement about DNA replication is false? | ||||||||||
|
15. | In many eukaryotes, there are repetitive sequences called telomeres at the ends of chromosomes. After successive rounds of DNA replication, the _______ strand becomes shorter. In some cells, an enzyme called _______ repairs the shortened strand. | ||||||||||
|
16. | A researcher studies normal human fibroblast cells. They can be maintained in culture but die off after about 30 cell generations. Unexpectedly, a colony of cells continues to survive and divide past 30 generations. Which scenario is most likely true for these cells? | ||||||||||
|
17. | If DNA polymerase III introduces an incorrect nucleotide, what is the first corrective action made by the DNA repair system? | ||||||||||
|
18. | Choose the correct order of the following four events in the excision repair of DNA: (1) Base-paired DNA is made complementary to the template. (2) Damaged bases are recognized. (3) DNA ligase seals the new strand to existing DNA. (4) Part of a single strand is excised. | ||||||||||
|
19. | Six complete cycles of PCR should result in a _______-fold increase in the amount of DNA. | ||||||||||
|
20. | When double-stranded DNA is heated to temperatures above 90°C, it denatures. Denaturation is a process that | ||||||||||
|
Question 4
Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)
Guanine histone Double helix Adenine conservative cytosine | Okazaki fragments Thymine introns Leading strand RNA polymerase 5-prime to 3-prime | Uracil chromatin DNA ligase Semi-conservative promoter | Lagging strand DNA polymerase nucleosomes Electron transport chain enhancer |
Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.
Question 5
In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."
Lactose | Glucose | Lac expression? |
No | Yes | |
Yes | Yes | |
Yes | No |
Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.
Question 6
Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)
a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:
5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â
b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.
c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?
QUESTION 1
A mutation caused by exposure to gamma rays is called a spontaneous mutation
a. | True | |
b. | False | |
c. | Sometimes, depending on the type of base change | |
d. | Gamma rays do not cause mutations |
QUESTION 2
A recessive mutation affecting an essential biochemical pathway can be detected________
a. | when the organism is heterozygous for that mutation. | |
b. | when the organism is homozygous for that mutation. | |
c. | in either homozygous or heterozygous conditions. | |
d. | only by sequencing (recessive mutations never show a phenotype). |
QUESTION 3
During DNA replication, the newly synthesized chain grows by adding
a. | nitrogenous bases | |
b. | the sugar-phosphate backbone | |
c. | nucleosides | |
d. | dNTPs |
QUESTION 4
During replication, the DNA strand 5â- AAGTCTAGCCTAG -3â will serve as a template for the polymerization of:
a. | 5â- CTAGGCTAGACTT -3â | |
b. | 5â - TTCAGATCGGATC -3â | |
c. | 5â - GATCCGATCTGAA -3â | |
d. | 3â - AAGTCTAGCCTAG -5â |
QUESTIOn 5
Given the following DNA sequences, select which statement(s) is(are) correct.
Sequence 1:
5â-TGGACGCTAA-3â
3â-ACCTGCGATT-5â
Sequence 2:
5â-AATCGCAGGT-3â
3â-TTAGCGTCCA-5â
Sequence 3:
5â-ACCTGCGATT-3â
3â-TGGACGCTAA-5â
a. | Sequences 1 and 2 are the same | |
b. | Sequences 1 and 3 are the same | |
c. | Sequences 2 and 3 are the same | |
d. | Sequences 1, 2 and 3 are all different |
QUESTION 6
Repetitive sequences in the genome are hotspots for:
a. | Deamination | |
b. | Depurination | |
c. | Thymine dimer formation | |
d. | Replication errors |
QUESTION 7
Select which statement(s) about the Ames test is(are) correct
a. | it has been designed to understand mutation repair systems in Salmonella typhimurium | |
b. | it uses mammalian liver extract | |
c. | it allows to study whether chemical compounds or their enzymatic breakdown products are mutagenic | |
d. | it is based on whether a chemical compound causes reversion mutations from his+ to his- | |
e. | two of the above are correct | |
f. | three of the above are correct |
QUESTION 8
Select which statement(s) is(are) correct.
a. | All DNA strands have a direction, and it is specified by the carbons in the sugar backbone. | |
b. | All DNA strands have a direction, and it is specified by hydrogen bonds between nucleotides. | |
c. | In order to form proper base pairs in a double stranded DNA molecule, the two strands must run in opposite directions. | |
d. | A and C are correct. | |
e. | B and C are correct. |
QUESTION 9
Studies of gene mutation frequencies have shown that:
a. | mutations are rare, and genomes are generally stable. | |
b. | mutation frequencies differ among organisms and also between genes, suggesting certain genes are more susceptible to mutation. | |
c. | mutation frequencies are consistent between organisms, and each region of DNA is equally susceptible to random mutations. | |
d. | Both A and B are correct. | |
e. | Both A and C are correct. |
QUESTION 10
The compound 5-bromodeoxyuridine (BrdU) is a derivative of uracil, and if BrdU becomes incorporated during DNA replication, it pairs with adenine. This compound is best classified as which type of mutagen?
a. | base analog | |
b. | base inducer | |
c. | intercalating agent | |
d. | oxidative agent | |
e. | alkylating agent |
QUESTION 11
The rate of mutation of the fruit fly is higher than the rate of mutation of Algae
True
False
QUESTION 12
Thymine dimers are most commonly caused by which of the following?
a. | X-rays | |
b. | Alkylating agents | |
c. | U.V. irradiation | |
d. | DNA intercalating agents |
QUESTION 13
What chemical group is found in the 3â end of a DNA strand?
a. | an alcohol | |
b. | a hydroxyl | |
c. | a methyl | |
d. | a phosphate |
QUESTION 14
What chemical group is found in the 5â end of a DNA strand?
a. | an alcohol | |
b. | a hydroxyl | |
c. | a methyl | |
d. | a phosphate |
QUESTION 15
Which is the correct order of molecules binding to DNA during DNA replication?
a. | Helicase, SSB, primase, DNA pol III, DNA pol I, ligase | |
b. | SSB, DNA pol I, ligase, helicase, DNA pol I, primase | |
c. | primase, helicase, DNA pol III, ligase, DNA pol I, SSB | |
d. | SSB, helicase, primase, DNA pol III, DNA pol I, ligase |
QUESTION 16
Which statement(s) is(are) correct about strand slippage?
a. | It can cause disorders such as Huntingon disease. | |
b. | It is a process that causes mutations altering the number of DNA repeats. | |
c. | It is a process that incorporates nucleotide base analogs and trinucleotide repeats. | |
d. | a and b are correct. | |
e. | b and c are correct. | |
f. | a, b and c are correct. |
help needed asap.