a) Using the template strand sequence below from a EUKARYOTE, transcribe it to mRNA, properly end modify it, and then translate it into protein. Do not worry about splicing, this is one of the rare genes with no introns. Use the single letter amino acid abbreviations when writing the protein sequence.
5â- GTTAACGCTTCAGGAGACACTTCCCGATAAGCACCATGGTGGCCCG -3â
1 2
b) If there is a transition mutation at the arrow labeled 1 and a transversion to a G at the arrow labeled 2, what will be the new mRNA and protein sequence become? Is the protein likely to be functional?
a) Using the template strand sequence below from a EUKARYOTE, transcribe it to mRNA, properly end modify it, and then translate it into protein. Do not worry about splicing, this is one of the rare genes with no introns. Use the single letter amino acid abbreviations when writing the protein sequence.
5â- GTTAACGCTTCAGGAGACACTTCCCGATAAGCACCATGGTGGCCCG -3â
1 2
b) If there is a transition mutation at the arrow labeled 1 and a transversion to a G at the arrow labeled 2, what will be the new mRNA and protein sequence become? Is the protein likely to be functional?
Related textbook solutions
Related questions
Part B
Think about the DNA coding sequence of a gene. If an A were swapped for a T, what kind of mutation could it cause and why?
| a) It could cause a frameshift nonsense or frameshift missense mutation because it would change the reading frame of the codon triplet. | ||||||||||||||||||||||||||||
| b) It could cause a silent, missense, or nonsense mutation because those are the types that can be caused by a nucleotide-pair substitution like this one. | ||||||||||||||||||||||||||||
| c) It could cause a nonsense mutation because the sequence would no longer be the same, so the protein would be shorter and non-functional. | ||||||||||||||||||||||||||||
| d) It could cause a silent mutation because A and T are complementary to each other so it is not really a substitution mutation. Part C Why is a frameshift missense mutation more likely to have a severe effect on phenotype than a nucleotide-pair substitution missense mutation in the same protein?
|
