🏷️ LIMITED TIME OFFER: GET 20% OFF GRADE+ YEARLY SUBSCRIPTION →
Log in
Biology
1
answer
0
watching
255
views

Unit 2: Genetics Assignment

In this assignment you will convert a DNA sequence into proteins through several steps. If you have no idea where to begin I recommend that you watch the “How to read the Genetic Code” and “Protein Synthesis” videos

Here is the DNA sequence:

TACCACGCCAAGCGAAGCGGGATT

Part 1: Transcribe the sequence into mRNA and separate the mRNA into codons. Name the enzyme responsible and the start and stop codons used.

Part 2: Give the tRNA anticodons that match the mRNA.

Part 3: Translate the mRNA into amino acids.

Part 4: Give an example of how a mutation to this sequence could cause a silent mutation.

Here’s an example that you can complete:

Normal DNA = CAC Mutated DNA = CAG

Normal mRNA = Mutated mRNA=

Normal amino acid = Mutated amino acid=

*What do you notice happened above?

*What does this tell you about the effect of a silent mutation?

Part 5: Give an example of how a mutation to this sequence could cause a missense mutation.

Here’s an example that you can complete:

Normal DNA = CAC Mutated DNA = GAC

Normal mRNA = Mutated mRNA=

Normal amino acid = Mutated amino acid=

*What do you notice happened above?

*What does this tell you about the effect of a missense mutation?

Part 6: Besides mutations how else do bacteria acquire new genes? Define each of these in your own words:

*transformation

*transduction

*conjugation

Watch
1
answer
0
watching
255
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Nestor Rutherford
Nestor RutherfordLv2
28 Sep 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

DNA and Genes Lab Activity
Complete your answers in the spaces provided. USE YOUR OWN WORDS – Yes even
for definitions! Remember to add your last name and first initial to the file name prior to
saving and submitting your completed assignment through Canvas.
Use your textbook, notes and these websites to answer the pre lab questions.
http://learn.genetics.utah.edu/content/molecules/transcribe/
http://www.vcbio.science.ru.nl/en/virtuallessons/cellcycle/trans/
Pre Lab Questions:
1. What is the product of transcription?
2. What is the region of DNA called where transcription begins?
3. What is the product of translation?
4. In your own words define each of the following:
Silent mutation
Missense mutation
Nonsense mutation
Frame shift mutation
5. Where in the cell does translation take place?
Click on the link below to access the online lab.
http://www.mhhe.com/biosci/genbio/virtual_labs_2K8/pages/DNA_And_Genes.html
Download and print the instructions for reference as you work through the lab. As you work through the lab fill in the table below. Use this information to answer the questions that follow contained in this document.
First read through the mutation guide. Once you close the guide you will see the buttons to begin the simulation. Note, you will be translating the mRNA strand into a protein. As you work through each of the mutations fill in the charts below. You must complete 4 mutations for this lab activity. It’s good practice working with the codon table .
– Aris labs calls the codon table the ‘Genetic Code Chart’. Use the amino acid abbreviation for the protein sequence. For example the amino acid proline is abbreviated as pro.
You have to fill in all the letters AND the resulting amino acid sequence by dragging and dropping before you click the [check] button. Abrieviate STOP as either STP or END.
For each of the three mutations you will complete, fill in the table in this lab document with the original mRNA and amino acid sequence and the mRNA sequence and the resulting amino acid sequence RESULTING FROM the mutation as outlined in the mutation rule.
The various mutations represent missense, nonsense, silent and frame shift mutations. You must complete one of each. The lab will not necessarily present the mutations in this order. You must do the mutation and identify which type it is and make sure you do one of each.
6. Frame Shift Mutation example:
Provide the mutation rule you are following.
Original A. Acids
Original mRNA
Mutated mRNA
Mutated A. Acids
7. Missense Mutation example:
Provide the mutation rule you are following.
Original A. Acids
Original mRNA
Mutated mRNA
Mutated A. Acids
8. Nonsense Mutation example:
Provide the mutation rule you are following.
Original A. Acids
Original mRNA
Mutated mRNA
Mutated A. Acids
9. Silent Mutation example:
Provide the mutation rule you are following.
Original A. Acids
Original mRNA
Mutated mRNA
Mutated A. Acids
Post Lab Questions
10. From the mutations you have explored, which one is the least severe. Explain your answer.
11. From the mutations you have explored, which one is the most severe. Why?
12. Aside from silent mutations which have no effect on amino acid sequence, are all mutations bad? Explain your answer.

The mature mRNA transcript for a gene with one exon is originally

5' AUGAGGGAAUCCCCUAGGUGA 3'

and a mutation inserts an additional G nucleotide after position 7 in the DNA sequence so that the mutated gene produces the modified mature mRNA transcript

5' AUGAGGGGAAUCCCCUAGGUGA 3'

The amino acid sequence of the protein coded by the original gene is 1)_and the amino acid sequence of the protein coded by the mutated gene is 2)_.This is an example of a 3)_ mutation.If 3 G nucleotides were instead inserted after position 7 it would be an example of a 4)_mutation.

For the following which one:

1) is it:

-MetGlueArgProArgArg

-ArgGluSerProArgMet

-MetArgGluSerProArg

-MetArgGlullePro

2) is it:

-ArgGluSerProArgMet

-MetArgGluSerProArg

-MetGluArgproArgArg

-MetArgGlyllePro

3) is it:

-splic-site

-silent

-synonymous

-frameshift

-missense

4) is it:

-splice-site

-synonymous

-silent

-frameshift

-missense

4. You are studying an interesting protein in nematode worms that is 100 amino acids in length. Of particular interest is the fact that the last seven amino acids are all tryptophan (codons 94 through 100).

a. Draw here the mRNA sequence for codons 94-100:

b. Draw here the sequence of the DNA strand RNA polymerase used as its template (show 5’ 3’ polarity):

c. You mutagenize the wild type worm. Assume for the next questions you are able to isolate both normal and mutant types of the protein and generate amino acid sequence. A fir mutant protein is 100 amino acids in length. The only change in sequence from wild type is that amino acid #100 is now arginine. Name the mutation type and explain the mutation as the codon change in the mRNA:

d. You mutagenize the wild type again, and now recover a new mutant protein. It’s 93 amino acids in length, and those 93 amino acids are wild type in sequence. Name the mutation type and explain the mutation as the codon change in the mRNA:

e. You mutagenize the wild type again and recover this time another new mutant protein. It’s 103 amino acids in length. The first 97 amino acids are wild type in sequence, but here’s the amino acid sequence from amino acids 98-103: -M-V-V-V-M-M-COOH Name the mutation type and explain the mutation at the level of mRNA change:

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in