answer

watching

views

8 Dec 2018

The mature mRNA transcript for a gene with one exon is originally

5' AUGAGGGAAUCCCCUAGGUGA 3'

and a mutation inserts an additional G nucleotide after position 7 in the DNA sequence so that the mutated gene produces the modified mature mRNA transcript

5' AUGAGGGGAAUCCCCUAGGUGA 3'

The amino acid sequence of the protein coded by the original gene is 1)_and the amino acid sequence of the protein coded by the mutated gene is 2)_.This is an example of a 3)_ mutation.If 3 G nucleotides were instead inserted after position 7 it would be an example of a 4)_mutation.

For the following which one:

1) is it:

-MetGlueArgProArgArg

-ArgGluSerProArgMet

-MetArgGluSerProArg

-MetArgGlullePro

2) is it:

-ArgGluSerProArgMet

-MetArgGluSerProArg

-MetGluArgproArgArg

-MetArgGlyllePro

3) is it:

-splic-site

-silent

-synonymous

-frameshift

-missense

4) is it:

-splice-site

-synonymous

-silent

-frameshift

-missense

answer

watching

114

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Patrina SchowalterLv2

9 Dec 2018

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

Related questions

Part B

Think about the DNA coding sequence of a gene. If an A were swapped for a T, what kind of mutation could it cause and why?

a) It could cause a frameshift nonsense or frameshift missense mutation because it would change the reading frame of the codon triplet.

b) It could cause a silent, missense, or nonsense mutation because those are the types that can be caused by a nucleotide-pair substitution like this one.

c) It could cause a nonsense mutation because the sequence would no longer be the same, so the protein would be shorter and non-functional.

d) It could cause a silent mutation because A and T are complementary to each other so it is not really a substitution mutation.

Part C

Why is a frameshift missense mutation more likely to have a severe effect on phenotype than a nucleotide-pair substitution missense mutation in the same protein?

a) A substitution missense mutation causes the protein to be shorter and thus non-functional.

b) A frameshift missense will cause the codons to be out of order, but a substitution missense does not change the order of the codons.

c) A frameshift missense mutation will cause an early Stop codon, but a substitution missense might be silent.

d) A substitution missense affects only one codon, but a frameshift missense affects all codons downstream of the frameshift.

Part D

Which of the following sequences shows a frameshift mutation compared to the wild-type mRNA sequence?

a) wild-type	5â-AUGCAUACAUUGGAGUGA-3â
mutant	5â-AUGCAUACAGAGUGA-3â

b) wild-type	5â-AUGCAUACAUUGGAGUGA-3â
mutant	5â-AUGCAUACGUUGGAGUGA-3â

c) wild-type	5â-AUGCAUACAUUGGAGUGA-3â
mutant	5â-AUGCAUACAUCUGGAGUGA-3â

d) wild-type	5â-AUGCAUACAUUGGAGUGA-3â
mutant	5â-AUGCAUGUGACAUUGGAGUGA-3â

Part F

Suppose that the triplet of nucleotides indicated in bold (AGC) spans two codons, that is, CTA and GCC. If the triplet AGC were deleted from this DNA coding sequence, what effect would it have on the resulting protein?

5â-ATGCTAGCCTATCGTAAC-3â

a) The two flanking codons would be altered, but the rest of the amino acid sequence would be the same because there would be no frameshift.

b) The entire amino acid sequence would be altered due to the frameshift.

c) All of the amino acids after the deletion would be altered due to the frameshift.

d) All of the amino acids up to the deletion would be altered due to the frameshift.

mauvetrout554

DNA and Genes Lab Activity
Complete your answers in the spaces provided. USE YOUR OWN WORDS â Yes even
for definitions! Remember to add your last name and first initial to the file name prior to
saving and submitting your completed assignment through Canvas.
Use your textbook, notes and these websites to answer the pre lab questions.
http://learn.genetics.utah.edu/content/molecules/transcribe/
http://www.vcbio.science.ru.nl/en/virtuallessons/cellcycle/trans/
Pre Lab Questions:
1. What is the product of transcription?
2. What is the region of DNA called where transcription begins?
3. What is the product of translation?
4. In your own words define each of the following:
Silent mutation
Missense mutation
Nonsense mutation
Frame shift mutation
5. Where in the cell does translation take place?
Click on the link below to access the online lab.
http://www.mhhe.com/biosci/genbio/virtual_labs_2K8/pages/DNA_And_Genes.html
Download and print the instructions for reference as you work through the lab. As you work through the lab fill in the table below. Use this information to answer the questions that follow contained in this document.
First read through the mutation guide. Once you close the guide you will see the buttons to begin the simulation. Note, you will be translating the mRNA strand into a protein. As you work through each of the mutations fill in the charts below. You must complete 4 mutations for this lab activity. Itâs good practice working with the codon table .
â Aris labs calls the codon table the âGenetic Code Chartâ. Use the amino acid abbreviation for the protein sequence. For example the amino acid proline is abbreviated as pro.
You have to fill in all the letters AND the resulting amino acid sequence by dragging and dropping before you click the [check] button. Abrieviate STOP as either STP or END.
For each of the three mutations you will complete, fill in the table in this lab document with the original mRNA and amino acid sequence and the mRNA sequence and the resulting amino acid sequence RESULTING FROM the mutation as outlined in the mutation rule.
The various mutations represent missense, nonsense, silent and frame shift mutations. You must complete one of each. The lab will not necessarily present the mutations in this order. You must do the mutation and identify which type it is and make sure you do one of each.
6. Frame Shift Mutation example:
Provide the mutation rule you are following.
Original A. Acids
Original mRNA
Mutated mRNA
Mutated A. Acids
7. Missense Mutation example:
Provide the mutation rule you are following.
Original A. Acids
Original mRNA
Mutated mRNA
Mutated A. Acids
8. Nonsense Mutation example:
Provide the mutation rule you are following.
Original A. Acids
Original mRNA
Mutated mRNA
Mutated A. Acids
9. Silent Mutation example:
Provide the mutation rule you are following.
Original A. Acids
Original mRNA
Mutated mRNA
Mutated A. Acids
Post Lab Questions
10. From the mutations you have explored, which one is the least severe. Explain your answer.
11. From the mutations you have explored, which one is the most severe. Why?
12. Aside from silent mutations which have no effect on amino acid sequence, are all mutations bad? Explain your answer.

champagnerat497

Fill in the blank. Elongation during translation does NOT involve ____________.

Question 16 options:

	the translation of codons according to the genetic code
	the formation of bonds catalyzed by the ribosome
	complementary base pairing between RNA molecules
	amino acids being linked together in a polypeptide
	reading the DNA template 3' to 5'

For a given gene, what establishes the reading frame for translation?

Question 17 options:

	the location of the enhancer relative to the gene
	the first three nucleotides at the 5' end of the mRNA
	the first three nucleotides at the 3' end of the mRNA
	the start codon in the mRNA
	the location of the promoter relative to the gene

Which of the following is the LEAST likely direct consequence of a substitution mutation?

Question 18 options:

	changing the length of a protein coded for by a gene
	changing one amino acid in a protein
	creating a stop codon
	eliminating a start codon
	changing the length of the DNA molecule containing a gene

Suppose that the pre-mRNA transcript from a eukaryotic gene is 30,000 nucleotides long, and the gene codes for a sequence of 300 amino acids. What is the best explanation for the relationship between these numbers?

Question 19 options:

	only the first 900 nucleotides of the pre-mRNA transcript are translated
	it takes 100 nucleotides to specify a single amino acid
	300 of the nucleotides in the transcript are important, and the rest are "junk"
	only the last 900 nucleotides of the pre-mRNA transcript are translated
	large portions of pre-mRNA transcripts are cut out during RNA processing

Suppose an individual is born into a population with a novel mutation. Is the new mutation an evolutionary change, and why?

Question 20 options:

	no, because it is not a big enough change to count
	yes, because new mutations are always adaptive
	yes, because the appearance of a new genetic variant is a genetic change in a population
	no, because not enough individuals have the mutation for it to matter
	no, because most mutations are not adaptive