🏷️ LIMITED TIME OFFER: GET 20% OFF GRADE+ YEARLY SUBSCRIPTION →
Log in
Biology
1
answer
0
watching
129
views

We have three plasmids: the cloning vector, pGEM, the one thatresult if BamHI had been used to construct the genomic library, andthe one that would result if EcoRI had been used to construct thelibrary. What is the expected number of DNA fragments that wouldresult from digesting...

pGEM with the restriction enzymes BamHI, EcoRI, and BamHI +EcoRI?

pGEM + BamHI insert with the restriction enzymesBamHI, EcoRI,and BamHI + EcoRI?

pGEM + EcoRI insert with the restriction enzymesBamHI, EcoRI,and BamHI + EcoRI?


Watch
1
answer
0
watching
129
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Casey Durgan
Casey DurganLv2
28 Sep 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

About Gene Cloning - EMERGENCY :(!!

Hello I have to write a report about the experiment I did aboutgene cloning and also have to answer few qns from the prof. I woudreally appreciate if anybody can help me and will thank you in apossible way. I am that desperate since this would be veryimportant for my grade :(

I don't know the insert gene and have to figure it out on NCBIBLAST search using the sequence.( I tried but I couldnt find onNCBI)

The cloning was with pGEX-4T-1 vector and unknown gene which isabout 700bp.

It says by using pGEX_3_primer, got the sequence, which would bereverse sequnece so I did reverse and it is

AAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTATCCCACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCA

TGGCCTTTGCAGGGCTGGCAAGCCACGTTTGGTGGTGGCGACCATCCTCCAAAATCGGATCTGGTTCCGCGTGG

ATCCACCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCA

AGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGA

GGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTC

AGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCG

AGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCT

GCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAA

GAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAG

CAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGT

GCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAA

CAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAGCGGCCGC

Then the qn is,

1.What is this gene? Where is the start and stop codon of thisgene coding sequence?

2.Would this gene translated in in-frame? Gst fusion?

3.What is the partial expected amino acid sequence of GST-YFPprotien?

4.Can you find the restriction enzyme site that we used? (BamHI,NotI)

5.To check weather the cloning was done or not, it is better touse one restriction enzyme that is on vector and the other is oninsert. In this case we used the same emzyme as we used for cloningwhich are BamHI and NotI. If we want to still use NotI but changeBamHI as different enzyme, what could it be?

1. A study was conduced to identify a liver cell gene (zed) that has a length of 3000 bp. A southern blot was prepared using DNA from the liver cell and a probe made to region 1600-2000 of zed. Analysis of the blot revealed that there are two spots present, one at 3000 and another at 2000. A plausible explanation for this observation is

A. there is an identical copy of this gene on another chromosome.

B. the gene was cut into two equal portions by a restriction enzyme.

C. there is another gene with sequence similar to gene zed

D. both: there is an identical copy of this gene on another chromosome and there is another gene with sequence similar to gene zed

E. no explanation can be given using the available data

2. Protein P is synthesized in relatively high amounts in human pancreas. This protein has been isolated and purified, but its amino acid sequence has not been determined. We wish to clone the gene for protein P.

(a) How can a probe be prepared to identify the gene for protein P?

(b) If we have prepared a radioactive messenger RNA as our probe in part(a), how could we verify that it is the mRNA for protein P?

(c) If we wish to make a gene library from the DNA of human pancreatic cells, we proceed by digesting the DNA with the restriction enzyme BamHI and then separating the fragments by agarose gel electrophoresis. The fragments are transfered (by southern blotting) onto a nitrocellulose filter and flooded with the radioactive probe. Following incubation, the filter is washed to remove any probe that has not specifically bound to one or more DNA fragments. Autoradiography of the filter reveals two bands of size 300 and 700 bp. When experiment is repeated using restraction enzyme PstI, only one band of 1000 bp appears. If it is already known that pancreatic cells contain a single copy of the gene of protein P, which of these enzymes should be used to construct our gene library?

A plasmid that carries two antibiotic resistance genes, to ampicillin and tetracycline, respectively, has one restriction site for EcoRI located within the tetracycline resistance gene. Eukaryotic DNA containing a gene of interest (g.o.i.) has been digested with diffferent restriction enzymes, none of which cut within the gene of interest sequence). The resultant fragments are added to plasmid DNA that has been digested with EcoR1 only; the mixture was then incubated with DNA ligase. Resulting plasmids (recombinant and otherwise) are added to competent bacteria lacking resistance genes and growing in nutrient broth. The bacteria are then plated and allowed to grow overnight producing isolated colonies. Samples of these colonies are then grown in four different media: nutrient broth plus ampicillin; nutrient broth plus tetracycline; nutrient broth plus ampicillin and tetracycline; and nutrient broth containing no antibiotics.

1. The bacteria containing the plasmid with the gene of interest successfully insertedin would grow in

A. Tthe nutrient broth only.

B. The nutrient broth, the ampicillin broth, and the tetracycline broth.

C. Tthe nutrient broth and the tetracycline broth only.

D. The ampicillin broth and the nutrient broth.E.Tthe ampicillin and tetracycline broth only.

2. Bacteria transformed with the plasmid alone (not containing any eukaryotic DNA), would grow

A. Only in the broth containing both antibiotics.

B. In the nutrient broth plus ampicillin, but not in the broth containing tetracycline.

C. In the broth containing tetracycline, but not in the broth containing ampicillin.

D. Only in the broth that contained no antibiotics.

E. In all four types of broth.

4. Bacteria that did not take up any plasmids at all would grow in which media?

A. The tetracycline and ampicillin broth only

B. The nutrient broth and the tetracycline broth only

C. The nutrient broth and the ampicillin broth only

D. The nutrient broth only

E. All four broths

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in