1
answer
0
watching
366
views

A research group has sequenced the cDNA and genomic DNA from a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences. cDNA: 5ʹ–ATTGCATCCAGCGTATACTATCTCGGGCCCAATTAAT - GCCAGCGGCCAGACTATCACCCAACTCGGTTACCTACTAG - TATATCCCATATACTAGCATATATTTTACCCATAATTTGTGTGT - GGGTATACAGTATAATCATATA–3ʹ Genomic DNA (contains one intron): 5ʹ-ATTGCATCCAGCGTATACTATCTCGGGCCCAAT - TAATGCCAGCGGCCAGACTATCACCCAACTCG - GCCCACCCCCCAGGTTTACACAGTCATACCATACA TACAAAAATCGCAGTTACTTATCCCAAAAAAACCTAG - ATACCCCACATACTATTAACTCTTTCTTTCTAGGTTACCTAC - TAGTATATCCCATATACTAGCATATATTTTACCCATAATTTGT - GTGTGGGTATACAGTATAATCATATA–3ʹ Indicate where the intron is located. Does the intron contain the normal consensus splice site sequences based on those described in Figure 14.19? Underline the splice site sequences, and indicate whether or not they fit the consensus sequence.

For unlimited access to Homework Help, a Homework+ subscription is required.

Keith Leannon
Keith LeannonLv2
29 Sep 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in

Related textbook solutions

Related questions

Weekly leaderboard

Start filling in the gaps now
Log in