Log in
Biology
1
answer
0
watching
230
views

22.What is the mRNA that will be produced. (Again start from the5 prime end and list each complementary RNA base in order all theway to the 3 prime end.) template)

23. What is the tRNA anticodon that will be needed to match thefirst mRNA codon in the sequence written for the answer to theprevious question?

24. What is the sequence of amino acids that will be produced bytranslating the mRNA sequence written for the answer to twoquestions above? (Read codons left to right)

26. How many codons are contained in the mRNA in the question22?

Watch
1
answer
0
watching
230
views

For unlimited access to Homework Help, a Homework+ subscription is required.

Nelly Stracke
Nelly StrackeLv2
29 Sep 2019

Unlock all answers

Get 1 free homework help answer.
Already have an account? Log in
Share

Related textbook solutions

Molecular Cell Biology
8 Edition,
Lodish
ISBN: 9781464183393
Biology: Science for Life with Physiology
6 Edition,
Belk
ISBN: 9780134555430
Concepts of Biology
OER Edition,
Openstax
ISBN: 9781938168116
Biology
2nd Edition, 2013
Openstax
ISBN: 9781947172517
Essentials of Biology
5 Edition,
Mader
ISBN: 9781259660269

Related questions

20. Identify four uses for transgenic organisms. The next groupof questions are based on the following information: DNA templatemolecule is: 5 prime (5') end: A-G-C-T-A-T-C-T-A-C-G-A: 3 prime(3') end

21. What will be produced by DNA replication? (Start from the 5prime end and list each complementary DNA base in order all the wayto the 3 prime end.)

22. What is the mRNA that will be produced. (Again start fromthe 5 prime end and list each complementary RNA base in order allthe way to the 3 prime end.) template)

23. What is the tRNA anticodon that will be needed to match thefirst mRNA codon in the sequence written for the answer to theprevious question?

24. What is the sequence of amino acids that will be produced bytranslating the mRNA sequence written for the answer to twoquestions above? (Read codons left to right)

26. How many codons are contained in the mRNA in the question22?

Unit 2: Genetics Assignment

In this assignment you will convert a DNA sequence into proteins through several steps. If you have no idea where to begin I recommend that you watch the “How to read the Genetic Code” and “Protein Synthesis” videos

Here is the DNA sequence:

TACCACGCCAAGCGAAGCGGGATT

Part 1: Transcribe the sequence into mRNA and separate the mRNA into codons. Name the enzyme responsible and the start and stop codons used.

Part 2: Give the tRNA anticodons that match the mRNA.

Part 3: Translate the mRNA into amino acids.

Part 4: Give an example of how a mutation to this sequence could cause a silent mutation.

Here’s an example that you can complete:

Normal DNA = CAC Mutated DNA = CAG

Normal mRNA = Mutated mRNA=

Normal amino acid = Mutated amino acid=

*What do you notice happened above?

*What does this tell you about the effect of a silent mutation?

Part 5: Give an example of how a mutation to this sequence could cause a missense mutation.

Here’s an example that you can complete:

Normal DNA = CAC Mutated DNA = GAC

Normal mRNA = Mutated mRNA=

Normal amino acid = Mutated amino acid=

*What do you notice happened above?

*What does this tell you about the effect of a missense mutation?

Part 6: Besides mutations how else do bacteria acquire new genes? Define each of these in your own words:

*transformation

*transduction

*conjugation

One strand of a section of DNA isolated from E. coli reads 5’ -GTAGCCTACCCATAGG-3’ A. Suppose that an mRNA were transcribed using the complement of this DNA strand as a template. What would the sequence of the mRNA in this region be? B. How many different peptides could potentially be made from this sequence of RNA? Would the same peptides be made if the other strand of DNA served as the template for transcription? C. What peptide would be made if translation started exactly at the 5/ end of the mRNA in Part A? When tRNAAla leaves the ribosome, what tRNA will be bound next? When the amino group of alanine forms a peptide bond, what bonds, if any, are broken, and what happens to tRNAAla?

Weekly leaderboard

Home
Homework Help 3,900,000
Biology 460,000
Start filling in the gaps now
Log in