what would happen if the sequence in the mRNA was not complimentary base paired correctly from the sequence in the DNA? (there is mutation in the sequence being used for protein synthesis)

answer

watching

946

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Keith LeannonLv2

12 Mar 2019

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

Related questions

A DNA sequence is 1500 nucleotides long. Answer the followingquestions:

How many amino acids does this sequence code for?

How many mRNA strands does this sequence code for?

How many proteins does this sequence code for?

Would it be more harmful if a mutation arose in the DNA sequenceor the mRNA sequence transcribed from it? Explain your answer (nocredit without an explanation)

A DNA sequence is 1500 nucleotides long. Answer the followingquestions:

How many amino acids does this sequence code for?

How many mRNA strands does this sequence code for?

How many proteins does this sequence code for?

Would it be more harmful if a mutation arose in the DNA sequenceor the mRNA sequence transcribed from it? Explain your answer (nocredit without an explanation)

2) For the hypothetical DNA sequence/gene below mark the start codon and the stop codon of the gene. TSS->

5âCATAAA| GCAAACAGGAGATGGGCCCCAAAAGCCATGAATGGGAGCGCGTATAATCATGATTTATAATCTAGG TATCTCACTGA3â

3âGTATTT| CTTTTGTCCTCTACCCGGGGTTTTCGGTACTTACCCTCGCGCATATTAGTACTAAATATTAGATCC ATAGAGTGACT5â

Terminator sequence

Promoter sequence

TSS-> transcription start site and direction of transcription

a) Which strand of the DNA shown above, the top or the bottom, is the template strand?

b) What is the sequence of the mRNA produced from this gene? Label the 5â and 3â ends.

c) What is the sequence of the protein produced from the mRNA in (b)? Label the N and C termini.

d) Generate two examples each that result in a silent mutation, a missense mutation, a nonsense mutation, and a frameshift mutation for the DNA sequence above. Show the respective amino acids below each codon. (Courier font is a font typically used for sequences.)