answer

watching

views

2 Jan 2019

A DNA sequence is 1500 nucleotides long. Answer the followingquestions:

How many amino acids does this sequence code for?

How many mRNA strands does this sequence code for?

How many proteins does this sequence code for?

Would it be more harmful if a mutation arose in the DNA sequenceor the mRNA sequence transcribed from it? Explain your answer (nocredit without an explanation)

answer

watching

336

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Sixta KovacekLv2

3 Jan 2019

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

Related questions

Which of the following is NOT a direct consequence of the fact that DNA polymerase can only build onto the end of an existing nucleic acid?

Question 6 options:

	DNA replication requires primers
	Bits of DNA are lost from the ends of your chromosomes in each successive round of replication
	RNA is involved in DNA replication
	The enzyme "primase" is needed for DNA replication
	There are multiple origins of replication on each eukaryotic chromosome

How does a nucleotide sequence code for a protein in nearly all living organisms?

Question 7 options:

	a sequence of 3 nucleotides can code for one of 64 different amino acids
	a sequence of 2 nucleotides can code for one of 64 different amino acids
	a sequence of 2 nucleotides can code for one of 20 different amino acids
	a sequence of 3 nucleotides can code for one of 20 different amino acids
	a sequence of 3 nucleotides can code for 3 different amino acids

Fill in the blanks. To make one strand of DNA, _________ monomers are linked together in a chain, forming a polymer we call a(n) ________ .

Question 8 options:

	nitrogenous bases, hydrogen bond
	nucleotide, nucleic acid
	amino acid, nucleic acid
	nucleotide, nitrogenous base
	amino acid, protein

Which of the following was NOT part of the ideas that Darwin used in his book On the Origin of Species?

Question 9 options:

	organisms vary in characteristics that affect survival and reproduction
	variation in traits is often heritable
	descent with modification explains life's unity and life's diversity
	organisms inherit characteristics from their parents that the parents acquired in their own lifetimes
	natural selection is a cause of adaptive evolution

Here is a hypothetical mRNA sequence:

5' G G A U G C U A G U A U G A 3'

What is the amino acid sequence encoded by this mRNA?

Question 10 options:

	Met-Ile-Val
	Asp-Ala-Ser-Met
	Met-Leu-Val
	Ser-Met-Ile-Val
	Gly-Cys

Unit 2: Genetics Assignment

In this assignment you will convert a DNA sequence into proteins through several steps. If you have no idea where to begin I recommend that you watch the âHow to read the Genetic Codeâ and âProtein Synthesisâ videos

Here is the DNA sequence:

TACCACGCCAAGCGAAGCGGGATT

Part 1: Transcribe the sequence into mRNA and separate the mRNA into codons. Name the enzyme responsible and the start and stop codons used.

Part 2: Give the tRNA anticodons that match the mRNA.

Part 3: Translate the mRNA into amino acids.

Part 4: Give an example of how a mutation to this sequence could cause a silent mutation.

Hereâs an example that you can complete:

Normal DNA = CAC Mutated DNA = CAG

Normal mRNA = Mutated mRNA=

Normal amino acid = Mutated amino acid=

*What do you notice happened above?

*What does this tell you about the effect of a silent mutation?

Part 5: Give an example of how a mutation to this sequence could cause a missense mutation.

Hereâs an example that you can complete:

Normal DNA = CAC Mutated DNA = GAC

Normal mRNA = Mutated mRNA=

Normal amino acid = Mutated amino acid=

*What do you notice happened above?

*What does this tell you about the effect of a missense mutation?

Part 6: Besides mutations how else do bacteria acquire new genes? Define each of these in your own words:

*transformation

*transduction

*conjugation

salmonrabbit236

1. How does DNA copy itself through the process ofreplication? What is meant by semi-conservativereplication?

2. What is the process of transcription? What is therole of mRNA and how does it relate to DNA?

3. What is the process oftranslation? What is the role of the ribosome and tRNA? How manyRNA nucleotides âcodeâ for an amino acid? How are the amino acidsconnected to make proteins?

4. How many amino acids are there? Is there more thanone codon for each amino acid?

5. Describe how a change in DNA sequence could result ina changed sequence of amino acids in a protein.

6. What is a regulatory region in DNA and how can itcontrol gene expression?

7. What is a transgenic organism?