BIOL 2400 Chapter Notes - Chapter 6: Genetic Disorder, Plasmodium, Inbreeding

54 views7 pages

azurehound660

5 Dec 2013

School

Department

Course

Professor

For unlimited access to Textbook Notes, a Class+ subscription is required.

Document Summary

Because diploid organisms carry two copies of each autosomal chromosome, they can have as many as two alleles for each gene or locus. Individuals carrying two copies of the same allele are homozygous at that locus, whereas individuals carrying two different alleles are heterozygous for the locus. Genetic locus the specific location of a gene or piece of dna sequence on a chromosome. When mutations modify the sequence at a locus, they generate new alleles variants of a particular gene or dna region. Alleles are mutually exclusive alternative states for a genetic locus. Populations contain a mixture of individuals, each with a unique genotype reflecting the alleles that they carry at all of their genetic loci. At any time, some alleles will be more common than others. Evolution is defined as any change in the frequency of alleles from one generation to the next.

Related Questions

4. Microsatellites are repeating sequences of 2-6 base pairs ofDNA. KAH is a hypothetical human microsatellite locus with arepeating sequence of CAGA. The locus is shown in the figure with20 bp of flanking DNA sequences that can serve as primers foramplification of the locus by PCR.

5â GTTACTTAGGTATTGCCGAT KAH ATCTTGTAACCTAT ACTGTG3â

3â CAATGAATCCATAACGGCTA LOCUSTAGAACATTGGATATGACAC 5â

a. You will use PCR to genotype individuals for the KAH locus.The primers should be 20 nucleotides long. Determine the sequencesfor the two primers required to amplify the KAH locus. Note thatyou must label the 5â and 3â ends of both primers. Also, primersequences, by designation, are always written in the 5â to 3âdirection. 1 pt

b. Assume two KAH alleles, one with 8 and another with 5 copiesof the repeating unit. Using the primers you have designed, whatwill be the sizes of the amplified PCR products for each allele? 1pt

c. There are actually four known alleles of the KAH locus with13, 10, 8, and 5 copies of the repeating unit. How many possiblegenotypes are there for these alleles, and what are they? 1 pt

d. One parent is heterozygous for the 13 and 8 alleles of theKAH locus and the other parent is heterozygous for the 8 and 5alleles. The two parents live with three children. When youdetermine the genotype of the two children, the two genotypes are(8, 5) and (13, 10). What can you conclude about the parentage ofthe two children? 1 pt

amaranthsquirrel102

Q1. Which of the following statements is true about the disease Kuru?
Kuru is caused by a virus, which is contracted by eating human brain material.
Kuru is caused by a prion (PrP), which is contracted by eating human brain material.
Kuru is caused by a recessive allele for PrP; if a person has two copies, he or she will develop Kuru.
Kuru is caused by a dominant allele for PrP; if a person has two copies, he or she will develop Kuru.
Kuru is caused by having one copy of the dominant allele and one copy of the recessive allele for PrP.

Q2. True or false: One can calculate the frequency of alleles in a population if the genotypes of the members of the population are known.

True False

Q3. The Hardy-Weinberg equation is p2 + 2pq + q2. In this equation, q2 stands for the frequency of ____________ in a population.

The recessive allele O

ne of the homozygous genotypes

The dominant allele

Heterozygous genotype

Q4. Which of the following descriptions best fits the relationship between the terms gene, allele, locus, and chromosome?

Alleles are different forms of a gene, which can be found at a locus on a chromosome.

Genes are made up of chromosomes, which can be found at a locus on an allele.

Chromosomes are different forms of a gene, which can be found at an allele on a locus.

A locus is made up of alleles, which can be found at a gene on a chromosome.

Q5. Mead and his colleagues proposed a hypothesis for the apparent heterozygote advantage for the PrP locus. What did they suggest as the basis for the high presence of both alleles?
History of cannibalism.
Protection from malaria.
Protection against plague.
They did not propose a heterozygotic advantage for the PrP locus.

Q7. A frog population has two alleles for skin color at the following relative frequencies: Allele SC1= 0.8, Allele SC2 = 0.2. Allele SC2 is:
Dominant
Recessive
Co-dominant
Impossible to determine dominance from the information given.

Q8. A bird population has two alleles for feather color at the following relative frequencies: Allele FC1 = 0.5, Allele FC2 = 0.5. Allele FC1 is:
Dominant
Recessive
Co-dominant
Impossible to determine dominance from the information given.

Q9. Use the following information for both questions 9 and 10: You encounter a few populations of millipedes with variation in skin color. Genotype can be inferred from coloration: CC millipedes are black, Cc millipedes are brown, and cc millipedes are yellow. [You can launch a calculator byclicking here.]

If one millipede population has 60 black individuals, 20 brown individuals, and 20 yellow individuals, what is the relative frequency of allele C in that population?

0.5
0.6
0.7
0.8
Impossible to calculate from the information given.

Q10. If another millipede population's allele frequencies are 0.5 for C and 0.5 for c, what is the expected frequency of the cc genotype in the population, if the population is in Hardy-Weinberg equilibrium?
0.125
0.25
0.5
1.0
Impossible to calculate from the information given.