capedbaldy

The gastrocnemius muscle inserts on the calcaneus via the _____ tendon.

The fibularis longus has a tendon that loops around the ____ and extends to the little toe.

what happened after transcription and translation

A person lifts a box and the mean rectified EMG recorded from his erector spinae muscles is 2.69 mV. Prior to the lift the same subject performed a maximal effort isometric trunk extension and his rectified EMG was 13.07 mV. What is the subject's normalised erector spinae activity to two decimal places and include the correct unit?

Please describe how the cardiovascular system responds to aging.

identify and describe EHR functionality for acute care facilities, considering the key clinical processes performed and data needed in such a facility.

Blue flower color (B allele) is dominant to white (b allele). In a population plants with white flowers (bb) are at a frequency of 0.04. What frequency of the alleles are for blue flower color (B)?

A substance was found to have a renal clearance that was lower than the glomerular filtration rate. In regards to this substance, what major processes of urine formation are certain to have occurred? Briefly explain why each of the three major urine formation processes either has or has not occurred.

Enteric bacteria such as Salmonella species, Shigella species, and Escherichia species, are typically found in the intestinal tract of farm animals such as chickens, cows, and pigs. Therefore, improperly prepared meat and meat products, e.g., eggs are often the route by which humans become infected with these pathogens. However, in recent years such foods as watercress, peanuts, and cucumbers have been implicated in transmission of such pathogens to humans. Which is the most likely explanation for this expanded list of tradition vehicles?

A) these enteric bacteria are normal microbiota for variety of plants

B) bacteria are able to migrate from animal holding sites, e.g., barns, to the field growing these vegetables

C) plants may be fertilized with human or animal waste, e.g., night soil

D) these enteric bacteria are purposefully added to these products as a form of biological warfare

In a population of 100 four-o'clock flowers there are 40 red-flowered plants (CRCR), 38 pink-flowered plants (CRCW), and 22 white-flowered plants (CWCW) what is the frequency of the CW allele in this population?

BOTH hypotheses on the origins of eukaryotes agree that

A) eukaryotic cells are chimeras with attributes of Archaea and Bacteria

B) the nucleated cell arose after the endosymbiosis event

C) the nucleated cell arose before the endosymbiosis event

D) the nucleated cell was a direct descendant of a bacterial cell

What part of the os coxa do you sit on?

What structure of the femur fits in the acetabular fossa?

What are the major steps for constructing a linkage map?

Which is superior to the other? The greater sciatic notch or the lesser sciatic notch?

Hypothetically, scientists could lower Earth's temperature by ______, in order to combat global warming.

what significant limitation does science impose on the types of phenomona that can be studied?

Which of the following can generate variation in a population?

a) Frequency dependent selection

b) Whole genome duplication

c) Genetic drift

d) Fixation of beneficial alleles

e) None of the above

In a population of giraffes, you find that 65% are heterozygotes at a locus that controls neck length. Is this population in Hardy-Weinberg equilibrium?

a) No, because the proportion of heterozygotes exceeds the maximum number possible under HWE.

b) No, because it is not possible for there to be fewer than 35% of homozygote dominant genotypes in a population under HWE.

c) Yes, because the proportion of heterozygotes matches the expectation under HWE.

d) Yes, because neck length in giraffes is not under selection.

e) Maybe, it depends on the frequency of the recessive homozygotes.

Beeps are sheep that breed like bees; within a herd of Beeps, there is only one reproductive female. Other females forego their own reproduction and become 'worker beeps', helping to rear the young of the reproductive 'queen beep'. Members of a colony are inbred, having an r of about 0.95. This is an example of :

a) Exploitation of kin cues by the queen to enhance her fitness at the expense of the workers.

b) Altruism on the part of the workers that rear the young of the queen as their own.

c) Parent-offspring conflict.

d) Exploitation of kin cues by the workers to enhance their fitness by tricking the queen into reproducing for them.

e) A parasitism where the fitness of the queen and the workers is enhanced.

The solution to the generation time problem of the molecular clock relies on:

a) The inverse relationship between generation time and population size

b) The relationship between the selection coefficient, s, and the number of new mutations.

c) The neutral theory and effect of neutral mutations on generation time.

d) The number of new mutations that are subject to heterozygote advantage and frequency dependent selection.

e) The relative number of homologies and homoplasies.

According to the neutral theory, most mutations are deleterious and most _______________ are neutral.

a) homoplasies

b) mutations

c) selective events

d) substitutions

e) eliminated variants

Comparing the gene for elongation factor 1 between two species of rotifers, you find that the rate of nonsynonymous substitution is 0.026 and the rate of synonymous substitution is 0.81. Which of the following can you conclude from these data?

a) This gene has experienced strong negative, or purifying, selection.

b) Most mutations in this gene are beneficial.

c) Mutations at synonymous sites have experienced heterozygote advantage.

d) More mutations occur at synonymous sites than nonsynonymous sites.

e) This gene is a pseudogene.

Which of the following is true of the current state of genome sequencing?

a) There are approximately 100 species that have been sequenced.

b) Humans, Drosophila, and C. elegans are the only eukaryotes that have been sequenced.

c) Genome sequencing is faster and cheaper than it was 10 years ago.

d) Bioinformatic algorithms have made eukaryotic genome assembly and annotation simple.

e) There is nothing interesting remaining to be learned from genome sequences.

A student prepares a Gram stain from 0.5 gram of soil. When this slide is observed under the microscope, only Gram negative rods were observed. Indicate which of the following statements are correct by filling in the blank after each statement with either Yes or No.

1)The microorganisms viewed on the slide are an accurate representation of all the microorganisms in the soil sample

2) The small sample size would account for the lack of diversity seen on the slide

3). The Gram stain works better on rod-shaped microorganisms than cocci-shaped microorganisms

4). The student forgot to heat fix the slide and this would explain the lack of diversity observed

Use examples to describe the impacts of CO2 at different levels of biological organization in marine ecosystems: individuals, populations, and communities. Use one example per level.

Identify two ways in which the integrity of a PCR reaction might be compromised?

14. A sex-­‐linked gene has three alleles, a1, a2, and a3 in an ideal population. The frequencies of phenotypes among the males are: a1, 0.2; a2, 0.3; and a3, 0.5. What is the percentage of a1a1 females in the population?

In a population, the numbers of individuals with the YY genotype is 520, there are 320 heterozygotes, and 160 Y’Y’ individuals. What is the frequency of the Y’ allele?

In a cell undergoing meiosis, there are 32 sister chromatids in the cell after the S phase of interphase. How many different outcomes are possible for the gametes?

Synaptic integration is most accurately described as

What is the wavelength, in nm, of a photon whose frequency is 5.09 x 1014 Hz?

The sequence below is the coding strand from a portion of a maize mRNA. The forward primer location is shown in (green) , the reverse in [red] . How big is the PCR product in base pairs?

5’ TTTTTAAACC(GACCCGTTGCAGATGTGAA)CACGAGAGCACTCCCATAATAACACCGATATTCCCTTCGGTCCAATGCCATCGTGTCTACCG[CTAATCTATCGCAGCCTTAC]CTATGGCCC 3’

Which of the following is an accepted criterion for defining a molecule to be a neurotransmitter?
A. it must be present in a postsynaptic cell
B. it mist be released in response to presynaptic electrical activity
C. it must exert an excitatory effect on the postsynaptic cell
D. All of the above
E. None of the above

McDonald’s Quandary Ronald McDonald wants to find out if he could sell even more hamburgers by providing nutritional information on his take out menus. In a large city, two McDonald’s Restaurants with similar daily sales are chosen to use for this experiment. Restaurant A will make no changes to their menu, Restaurant B will add calorie counts to all hamburger options on the menu. At the end of the experimental period, Restaurant A had sold 550 hamburgers. Restaurant B had sold 650 hamburgers.

A. Which restaurant is the control?

B. What is the experimental variable?

C. What conclusions, if any, can be drawn from this data?

D. Should this information be used to make predictions about other McDonald’s locations? Why or why not?

E. Outline two issues with this experiment. (There are many, just pick 2)

BIOL 1014 Lab 1 Scientific Method (Continued) 2 – Jet Skis and Coral A marine biologist believes that trace fuel emissions of pleasure craft such as jet skis and boats are having a negative effect on the growth rate of a coral species that lives off a public beach. The biologist designs an experiment in the lab exposing Tank A of coral to traces of fuel and Tank B is exposed to no fuel traces. Both tanks have the same amount of sunlight, are given the same nutrients, have the same salt concentration and atmospheric conditions. Over a period of several months, the biologist monitors the growth patterns of each tank and discovers the tank without the fuel (Tank B) actually reproduced less than the tank with the traces of fuel (Tank A).

A. What is the above biologist’s hypothesis?

B. Which tank contains the control group?

C. Which tank contains the experimental group?

D. What is the experimental variable?

E. Does the data collected support the original hypothesis of the biologist? Why or why not?

F. What are two possible problems with this experiment, or sources of error?

BIOL 1014 Lab 1 Scientific Method (Continued) 3 - Crossword Contest Time to Solve Weekly

Crossword

The Simpson family decided to have a crossword puzzle contest. (Maggie can’t read and Marge is way too busy.) The Nuclear Meltdown Press has a weekly crossword in its Springfield edition. Each week, when the puzzle arrives, Bart, Lisa and Homer time themselves and record the time it takes for them to complete the puzzle.

A. Based on the data above, which Simpson is the fastest with crossword puzzles?

B. In this “experiment” what can you identify as the experimental variable?

C. What are two possible explanations for the differences observed between the subjects in this study?

D. What additional experiments could you recommend to better determine what may have caused these differences?

Action potentials propagate ("spread") in only one direction from the cell body toward the axon terminal. What is the underlying cause of this?

1.What benefit can human stem cells provide to individuals with a genetically determine immunodeficiency? How would the process work? Can individuals receive their own stem cells? (5 marks)

2.Fill in the blanks with the missing information about primary and secondary lymphoid organs: (6 marks)

The ___________ is the site of T cell development and maturation. The ________ is the site of B cell differentiation and hematopoesis.

The ___________ are the sites where immune responses are mounted to antigens in the lymph. The _____________ is where immune responses are mounted to antigens in the blood. The ___________ is lymphoid tissue that responds to antigen in the digestive, respiratory, and urogenital systems. Epithelial cells lacking microvilli that transport the antigens to these tissues are known as ________.

3. Describe the structure of the B-cell receptor (BCR). How is the BCR able to trigger a signal transduction pathway when its cytoplasmic tail is only 3 amino acids in length? Outline BCR signal transduction from the point of antigen binding through the NF-κB pathway. What is the result of signal transduction events from the BCR? (10 marks)

4.What is agammaglobulinemia? What enzyme is mutated in these patients and what is this enzyme’s function? What happens to people with this disorder? (5 marks)

5.What is Lck and why is it important? What would happen to a T cell if a mutation were introduced in Lck? (5 marks)

6.Define the following and give an example for each: (8 marks)

cytokine

interleukin

chemokine

chemoattractant

7.What common cytokines induce differentiation of TH1 and TH2 subsets? (5 marks)

Neurons exhibit a threshold above which an action potential is triggered because of:
a. a positive feedback loop between sodium current activation and potassium activation
b. a positive feedback loop between depolarization and sodium current activation
c. a negative feedback loop between sodium current activation and inactivation
d. the precise time constant of sodium channel activation (ie a threshold would not be observed if this were measurably charged)
e. pacemaker-like activity that's present in all cells

Hello, why is this statement *false*? I know more carbon causes more oxygen to dissociate from hemoglobin.

As carbon dioxide enters systemic blood, it causes more oxygen to dissociate from hemoglobin (the Haldane effect), which in turn allows more CO2 to combine with hemoglobin and more bicarbonate ion to be generated (the Bohr effect).

if an individual is unconsious. it is common medical practice to open the eye lid and shine a light. why is this procedure done?