BIOL 2153 Study Guide - Peptide, Genetics (Journal), Mitosis

34 views6 pages

goldsnake374

18 Jun 2014

School

Department

Course

Professor

For unlimited access to Study Guides, a Grade+ subscription is required.

Document Summary

Structure of dna: covalently bonded sequence of base pairs ( deoxyribose phosphodiester backbone) polypeptides in dna phosphate, sugar, & nitrogen containing base. Roles of dna and mrna in the cell: replication (preserve genetic info) & gene expression. [(genes)(aa)(3)] / [(bp)] x 100 = percent of genome (3) x (# of codons) = nucleotides. How does the sequence of bases code for a sequence of amino acids in a protein? . Gene expression: info in genes expressed as protein for cell functions. Converts sequence of nucleotides to sequence of aacids in a protein through transcription and translation. Translation: converting mrna to amino acids for a polypeptide. It changes the dna sequence and then the sequence to encode for the proper protein. Kinetochore: the two items that pull/hold each chromatid against the other. Anaphase: movement of chromosomes to poles and splitting of centromere. Prophase: disappearance of nuclear membrane, condensation of chromosomes, and formation of mitotic spindle.

Related Questions

Which of the following is NOT a direct consequence of the fact that DNA polymerase can only build onto the end of an existing nucleic acid?

Question 6 options:

	DNA replication requires primers
	Bits of DNA are lost from the ends of your chromosomes in each successive round of replication
	RNA is involved in DNA replication
	The enzyme "primase" is needed for DNA replication
	There are multiple origins of replication on each eukaryotic chromosome

How does a nucleotide sequence code for a protein in nearly all living organisms?

Question 7 options:

	a sequence of 3 nucleotides can code for one of 64 different amino acids
	a sequence of 2 nucleotides can code for one of 64 different amino acids
	a sequence of 2 nucleotides can code for one of 20 different amino acids
	a sequence of 3 nucleotides can code for one of 20 different amino acids
	a sequence of 3 nucleotides can code for 3 different amino acids

Fill in the blanks. To make one strand of DNA, _________ monomers are linked together in a chain, forming a polymer we call a(n) ________ .

Question 8 options:

	nitrogenous bases, hydrogen bond
	nucleotide, nucleic acid
	amino acid, nucleic acid
	nucleotide, nitrogenous base
	amino acid, protein

Which of the following was NOT part of the ideas that Darwin used in his book On the Origin of Species?

Question 9 options:

	organisms vary in characteristics that affect survival and reproduction
	variation in traits is often heritable
	descent with modification explains life's unity and life's diversity
	organisms inherit characteristics from their parents that the parents acquired in their own lifetimes
	natural selection is a cause of adaptive evolution

Here is a hypothetical mRNA sequence:

5' G G A U G C U A G U A U G A 3'

What is the amino acid sequence encoded by this mRNA?

Question 10 options:

	Met-Ile-Val
	Asp-Ala-Ser-Met
	Met-Leu-Val
	Ser-Met-Ile-Val
	Gly-Cys

QUESTION 1. Choose the true statement about prokaryotic and eukaryotic DNA replication.

A.Eukaryotic DNA replication involves less protein factors than does prokaryotic DNA replication.

B. Prokaryotic DNA polymerases replicate DNA 5' to 3', while eukaryotic DNA polymerases replicate DNA 3' to 5'.

C. Eukaryotic DNA replication begins at multiple origins of replication, while prokaryotic DNA replication begins at a single origin of replication.

D. Prokaryotic genomes take longer to replicate than eukaryotic genomes.

QUESTION 2. Bacterial cells use DNA replication to:

A. make back-up copies of their genome in case of a mutation.

B. manifest multiple phenotypes at once.

C. copy their genetic material prior to binary fission.

D. build functional proteins.

QUESTION 3. Choose the true statement about the genetic code.

A. A cell's mRNA code is read four nucleotides at a time to specify a single amino acid.

B. The genetic code encodes 64 amino acids, one for each of the 64 corresponding codons.

C. The genetic code is redundant, with multiple codons specifying a single amino acid.

D. The genetic code varies widely among organisms, with each having a different set of codons for a corresponding amino acid.

QUESTION 4. Of the following enzymes, which are correctly matched with their function? To be marked correct, you'll need to select all correctly matched statements, as there may be more than one correct answer.

A. Helicase, relieves torsion stress as DNA unwinds

B. Ligase, covalently bonds adjacent Okazaki fragments

C. Primase, removes RNA primers

D. DNA polymerase III, builds most of the DNA on the leading and lagging strand

QUESTION 5. Which of the following contributes to DNA replication accuracy? To be marked correct, you'll need to select all true statements, as there may be more than one correct answer.

A. The capacity to proofread improves DNA replication accuracy.

B. A slow rate of DNA replication contributes to accuracy.

C. The use of primase improves DNA replication accuracy.

D. DNA replication accuracy is improved thanks to complementary base pairing rules.

Unit 2: Genetics Assignment

In this assignment you will convert a DNA sequence into proteins through several steps. If you have no idea where to begin I recommend that you watch the âHow to read the Genetic Codeâ and âProtein Synthesisâ videos

Here is the DNA sequence:

TACCACGCCAAGCGAAGCGGGATT

Part 1: Transcribe the sequence into mRNA and separate the mRNA into codons. Name the enzyme responsible and the start and stop codons used.

Part 2: Give the tRNA anticodons that match the mRNA.

Part 3: Translate the mRNA into amino acids.

Part 4: Give an example of how a mutation to this sequence could cause a silent mutation.

Hereâs an example that you can complete:

Normal DNA = CAC Mutated DNA = CAG

Normal mRNA = Mutated mRNA=

Normal amino acid = Mutated amino acid=

*What do you notice happened above?

*What does this tell you about the effect of a silent mutation?

Part 5: Give an example of how a mutation to this sequence could cause a missense mutation.

Hereâs an example that you can complete:

Normal DNA = CAC Mutated DNA = GAC

Normal mRNA = Mutated mRNA=

Normal amino acid = Mutated amino acid=

*What do you notice happened above?

*What does this tell you about the effect of a missense mutation?

Part 6: Besides mutations how else do bacteria acquire new genes? Define each of these in your own words:

*transformation

*transduction

*conjugation

salmonrabbit236

BIOL 2153 Study Guide - Peptide, Genetics (Journal), Mitosis

Document Summary

Get access

Related Documents

BIOL 2153 Chapter : SG1 Part 1

BIOL 2153 : Study Guide For Exam 1

BIOL 2153 Study Guide - Quiz Guide: Sister Chromatids, Hbb, Cytokinesis

Related Questions