BIOLOGY 1A03 Chapter Notes - Chapter 5: Punnett Square, Mendelian Inheritance, Ovule

68 views4 pages

harlequindinosaur92

22 Mar 2017

School

Department

Course

Professor

For unlimited access to Textbook Notes, a Class+ subscription is required.

doinhumolalala and 39849 others unlocked

BIOLOGY 1A03 Full Course Notes

Verified Note

9 documents

Document Summary

The basic rst principals if inheritance (mendel), chromosome dynamics, and mendelian ratios. Transferability of mendel"s principle across all sexually reproducing organisms. The only cells in the human body not produced by mitosis. In the production of male gametes, 4 haploid sperm cells come from 1 precursor, in females, 1 egg and 3 polar bodies come from 1 precursor. Pairing and physical connection of homologous chromosomes facilitated by synaptonemal complex that holds them together. Recall that each chromosome was inherited from a different parent, and therefore has different versions of alleles. The process of crossing over , or exchanging corresponding segments of dna molecules between homologous pairs. All homologous chromosomes pair with each other during synapsis (formation of a bivalent unit) Sister chromatids are identical, non-sister chromatids are similar but not identical. Crossing over is a random process that can occur anywhere along the length of the paired homologous chromosomes.

Related Questions

-Complete the following sentences: metaphase of mitosis, prophase II of meiosis, crossing over, anaphase I of meiosis, variable, random fertilization, identical, random orientation, metaphase I of meiosis, prophase I of meiosis, metaphase II of meiosis, reduction division

Two processes that occur during meiosis produce genetically ____________ cells.

In a process called ____________ , paired homologous chromosomes align randomly at the cell equator. This occurs during this stage of cell division: ____________ .

In a process called ____________ , genetic material is exchanged between homologous chromosomes. This occurs during this stage of cell division: ____________ .

-Complete the following paragraph to describe nondisjunction and the resulting effects on chromosome number.

words: euploidy, primary nondisjunction, nomal, nondisjunction, secondary nondisjunction, homologous chromosomes, abnormal, trisomy, monosomy, sister chromatids, aneuploid

1.During meiosis I, ____________ separate and move towards opposite ends of the poles.

2.During meiosis II, ____________ separate and move towards opposite ends of the poles.

3.During meiosis I, if both members of a homologous pair go into the same daughter cell, ____________ is said to occur and no normal gametes are produced.

4.During meiosis II, if the sister chromatids fail to separate and both daughter chromosomes go into the same gamete, ____________ is said to occur. Half the gametes are aneuploid while the other half are euploid.

5.If an egg that contains 24 chromosomes instead of 23 chromosomes is fertilized by a normal sperm, ____________ is said to have occurred.

6.If an egg that contains 22 chromosomes instead of 23 chromosomes is fertilized by a normal sperm, ____________ is said to have occurred.

PLEASE answer ALL THE QUESTIONS. DO NOT ANSWER IF YOU CANT ANSWER ALL OF IT.

3'- GGCCTTAAGCATGCATGCAT -5'

5'- CCGGAATTC(G)TACGTACGTA -3'

1. If a replication fork is moving from right to left along this DNA structure, which strand is the lagging strand template?

a) not enough information is provided

b) top strand

2. Which of the following occurs during Metaphase I of meiotic cell division?

a) Tetrads composed of homologous chromosomes line up at the center of the cell

b) homologous chromosomes separate

c) sister chromatid pairs line up at the center of the cell

d) non-sister chromatids exchange regions of DNA

3. A gerbil is a diploid organism with 58 chromosomes. Which of the following is true?

a) a gerbil cell in G2 phase has 58 chromosomes and 116 sister chromatids

b) a gerbil cell in Prophase has 58 chromosomes and 58 sister chromatid

c) a gerbil cell in Metaphase has 58 chromosomes and 58 sister chromatid

4. At the end of elongation and during the termination of replication on the leading strand, place the following events in the correct chronological order.

I. DNA pol I synthesizes DNA

II. DNA ligase seals the nicks in the daughter DNA

III. DNA pol I removes the RNA primers

IV. DNA pol III synthesizes DNA

a) IV-III-I-II

b)I-III-IV-II

c) III-I-II-IV

5. A gene for hair color (brown vs. blond) and a gene for finger length (long vs. short) are found on two different chromosomes. If a blond haired, long fingered mother is homozygous for hair color and homozygous for finger length, what is the probability that she passes along the preference for her son to have blond hair and long fingers?

a) 0%

v) 100%

c) 25%

6. For oxytocin signaling between two neurons, what is the correct order of events?

I. an oxytocin vessicle fuses with the plasma membrane

II. an oxytocin vessicle docks with plasma membrane

III. oxytocin molecules bind to the oxytocin receptor at the plasma membrane of the receiving neuron

IV. oxytocin molecules diffuse into the synapse

a) I-III-II-IV

b) II-I-IV-III

c) I-II-III-IV

7. The independent assortment of chromosomes is due to events that occur during ______.

a) meiosis I only

b) meiosis II only

c) mitosis and meiosis II

champagnemole592

Question 1

The process by which RNA is synthesized using DNA as a template is â¦

Select one:

a. replication

b. transcription

c. translation

d. inspiration

Question 2

Which of the following occurs during meiosis but not mitosis?

Select one:

a. DNA condenses into chromosomes

b. nuclear envelop disappears

c. homologous chromosomes separate

d. sister chromatids separate

Question 3

Which part of the animal life cycle is haploid?

Select one:

a. gamete

b. zygote

c. sporophyte

d. spore

Question 4

Single celled eukaryotic organisms are â¦

Select one:

a. viruses

b. bacterial

c. archaea

d. protists

Question 5

Which type of cellular division results in the formation of diploid cells from a diploid parent cell?

Select one:

a. mitosis

b. meiosis

c. interphase

d. A and B but not C

e. all of the above

Question 6

A sequence of DNA that codes for a single protein is a â¦

Select one:

a. gene

b. ribosome

c. mRNA

d. none of the above

Question 7

Which of the following is characteristic of animals?

Select one:

a. heterotrophic

b. sexual reproduction

c. embryonic development

d. all of the above

Question 8

All genes have only two possible alleles.

Select one:

True

False

Question 9

The presence of membrane-bound organelles is characteristic of â¦

Select one:

a. prokaryotes

b. viruses

c. bacteria

d. eukaryotes

Question 10

What are the building blocks of proteins?

Select one:

a. fatty acids

b. amino acids

c. nucleic acids

d. all of the above

Question 11

During which phase of the cell cycle does DNA replication occur?

Select one:

a. Mitosis

b. Interphase

c. Meiosis

d. Replicosis

Question 12

Which of the following characteristic is shared among fungi and animals?

Select one:

a. autotrophic

b. heterotrophic

c. cell walls

d. absorb nutrients

Question 13

A error in DNA replication that goes unrepaired is a â¦

Select one:

a. chromosome

b. chromatid

c. mutation

d. none of the above

Question 14

Alternate forms of a gene are called ________.

Select one:

a. chromatids

b. chromosomes

c. ribosomal subunits

d. alleles

Question 15

The physical expression of a genotype is the phenotype.

Select one:

True

False

Question 16

In complete dominance, a heterozygous genotype results in â¦

Select one:

a. a recessive phenotype

b. a dominant phenotype

c. a third and unique phenotype

d. none of the above

Question 17

Which theory explains the evolution of eukaryotes from prokaryotes?

Select one:

a. phagocytosis

b. endosymbiosis

c. pinocytosis

d. none of the above

Question 18

Which scientist experimented with plants to describe patterns of inheritance?

Select one:

a. Mendel

b. Chase

c. Einstein

d. Watson

Question 19

Which cellular organelle contains aerobic cellular respiration?

Select one:

a. chloroplasts

b. mitochondria

c. nucleus

d. lysosome

Question 20

Which of the following statements is false?

Select one:

a. Haploid gametes are formed by meiosis

b. Mitosis forms genetically identical daughter cells

c. Mitosis results in the formation of four daughter cells from a single parent cell

d. Mitosis forms diploid daughter cells from a diploid parent cell

Question 21

The first forms of life on Earth were ________.

Select one:

a. plants

b. microorganisms

c. birds

d. dinosaurs

Question 22

Which of the following is used to separate chromosomes during nuclear division?

Select one:

a. cytoskeleton

b. microtubules

c. actin and myosin

d. amoeboid movement

e. all of the above

Question 23

Which generation is most dominant in more primitive plants?

Select one:

a. bryophyte

b. sporophyte

c. gametophyte

d. androphyte

Question 24

Which of the following is characteristic of plants?

Select one:

a. autotrophic

b. contain chloroplasts

c. multicellular

d. all of the above

Question 25

During which phase of mitosis do chromosome line up along the middle of the cell?

Select one:

a. prophase

b. metaphase

c. anaphase

d. telophase

Question 26

During which phase of mitosis does DNA condense into distinct chromosomes?

Select one:

a. prophase

b. metaphase

c. anaphase

d. telophase

Question 27

The process by which DNA is used as a template to make new DNA is â¦

Select one:

a. translation

b. replication

c. transcription

d. allocation

Question 28

Which of the following is characteristic of plant but not animal cells?

Select one:

a. chloroplasts

b. water vacuole

c. cell wall

d. all of the above

Question 29

Which meiotic division is most like mitosis?

Select one:

a. Meiosis I

b. Meiosis II

c. Meiosis III

d. Meiosis IV

Question 30

Which enzyme catalyzes replication?

Select one:

a. DNA polymerase

b. RNA polymerase

c. Ribosome

d. all of the above

BIOLOGY 1A03 Chapter Notes - Chapter 5: Punnett Square, Mendelian Inheritance, Ovule

BIOLOGY 1A03 Full Course Notes

Document Summary

Get access

Related Documents

BIOLOGY 1A03 Lecture Notes - Lecture 26: Sister Chromatids, Nuclear Membrane, Chromosomal Translocation

BIOLOGY 1A03 Lecture Notes - Lecture 13: Sister Chromatids, Nuclear Membrane, Decay Product

BIOLOGY 1A03 Lecture Notes - Lecture 21: Natural Selection, Trematoda, Sister Chromatids

Related Questions