BIOCHEM 2EE3 Lecture Notes - Lecture 3: Heterocyclic Compound, Imidazole, Hydrogen Bond

43 views22 pages

indigohornet100

3 Apr 2018

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

2 dna strands - interact via non-covalent hydrogen bonds. G and t cannot bind together because the cannot make hydrogen bonds because they do the same geometry and disturb the helix. Stacking interactions - pi pi - van der waals - allow for stability. Due to two grooves dna can act in a specific or non specific manner. Made up of building blocks called nucleotides that are covalently linked to one another vi. 5" phosphate of one nucleotide and 3" hydroxyl of another monomer. Nucleotide ey don"t have er via phosphodiester bond. Purine structure - heterocyclic aromatic organic compound, pyrimidine ring fused to an imidazole ring. Heterocyclic aromatic organic compound contain pyrimidine ring fused to imidazole ring. Strong acid with pka = 1, that"s why dna and rna are acidic. At physiological ph carries a net negative charge. Dna will have on end with a free phosphate group because it is a linear molecule, this is t.

Related Questions

Nitrogen and phosphorus are in the same column of the periodic table. They have similar properties in bonding with other molecules because they have the same number of:

We cannot answer this question definitively because there is not enough information.

What I choose are wrong.

Match each term with its definition. Each term or definition is used only once

- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	right-spiraling common DNA form
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	referencing the opposite orientation of hydrogen-bonded DNA strands
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	viral particle whose natural host is a prokaryote
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	universal holding that the number of purines always equals the number of pyrimidines
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	nucleic acid base sequences able to form a double-stranded structure by virtue of matching base pairs
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	5ââ 3â or 3ââ 5â
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	nuclease able to cleave phosphodiester linkages in the DNA backbone
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	the structure formed by two DNA strands twisted around a common axis in a spiral
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	bacterial cycle of phage- infected cells resulting in cell destruction and viral release
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	main access site for proteins that recognize specific DNA sequences
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	a cytosine modification favoring Z DNA formation
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	nucleic acid monomer consisting of a sugar, a phosphate group, and a nitrogenous base
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	connects two nucleic acid sugar molecules via an ester bond
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	hydrolyzes peptide bonds linking amino acids
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	U or C in RNA
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	a pentose sugar
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	an enzyme that breaks down RNA
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	either of the two nucleotide chains of a double helix
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	a pyrimidine able to hydrogen bond with adenine
- A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T.	a DNA configuration favored by high ionic strength and GC repeats

A.	protease
B.	lysis
C.	double helix
D.	bacteriophage
E.	complementary
F.	Chargaffâs rule
G.	B DNA
H.	major groove
I.	nucelotide
J.	antiparallel
K.	RNAse
L.	directionality
M.	phosphodiester linkage
N.	ribose
O.	Z DNA
P.	pyrimidine
Q.	methylation
R.	DNAse
S.	uracil
T.	strand

magentaraven576

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BIOCHEM 2EE3 Lecture Notes - Lecture 3: Heterocyclic Compound, Imidazole, Hydrogen Bond

Document Summary

Get access

Related Documents

BIOCHEM 2EE3 Lecture Notes - Lecture 5: Nucleoside Triphosphate, Deoxyribose, Amine

BIOCHEM 2EE3 Lecture Notes - Lecture 3: Imidazole, Polynucleotide, Pyrophosphate

BIOCHEM 2EE3 Chapter Notes - Chapter 4: Dna Replication, Glycosidic Bond, Phosphodiester Bond

Related Questions