BIOL150 Lecture 5: biol 150 Lecture 5: biol 130 Lecture 5: Unit 5 - Gene Expression

57 views12 pages

chocolatetrout492

14 Dec 2015

School

University of Waterloo

Department

Biology

Course

BIOL150

Professor

Todd Holyoak

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

Many genes code for rna molecules that are not mrna. These rnas are involved in: do not code for proteins, regulation of gene transcription, processing of mrna prior to translation, translation. Different types of rna found in a cell. Form the core of the ribosome and catalyze protein synthesis rrnas o: regulate gene expression, serve as adaptors between mrna and amino acids during protein trnas synthesis. Other small rnas: used in rna splicing, telomere maintenance and other processes. Only one strand of dna transcribed: template strand. Other dna strand called non-template (coding) strand: sequence of coding" dna strand matches rna, except that rna has uracil (u) in place of thymine (t) Large, globular enzyme with several channels running through it. Active site is at the intersection of these channels. Holoenzyme made up of a core enzyme, which has the ability to synthesize rna and a regulatory subunit (sigma factor) Recognizes two different sections of dna to begin transcription process.

Related Questions

RNA has many different roles in gene expression. Check all thatapply.

mRNA defines the polypeptide to be formed

DNA defines the polypeptide to be formed

rRNA, along with proteins, forms the ribosome

mRNA delivers the appropriate amino acid to the ribosome

tRNA delivers the appropriate amino acid to the ribosome

Translation is appropriately named because the process transfersthe code from DNA to RNA, though in complementary fashion.

True

False

The template strand is to the sense strand as the coding strandis to the antisense strand.

True

False

The phenomenon symbolized by DNA â RNA â Protein is referred toas the Central Dogma because it is true for all organisms.

True

False

The reading frame refers to the selection of the correct tripletof nucleotides by selecting the correct beginning point. If thebeginning point is wrong, all nucleotides will be clustered intothe wrong codons.

True

False

Activating enzymes need to recognize only one anticodon.

True

False

coffeehorse275

5. Alpha amanitin is a drug that binds RNA polymerase andprevents it from functioning in the cell (this is the compound thatis found in poison mushrooms). The reason people die when theyconsume alpha amanitin is:

a) Alpha amanitin prevents gene expression from occurring in thecell

b) DNA replication is directly inhibited by alpha amantin

c) Alpha amanitin binds tightly to the messenger RNAs that aremade in the cell, preventing translation

d) Alpha amanitin binds to nuclear pores preventing thetransport of messenger RNA into the cytoplasm

6. In order for transcriptional initiation to begin in E. colithe following elements are needed:

a) an origin and RNA polymerase

b) initiator protein and a promoter

c) the sigma subunit of RNA polymerase and an RNA template

d) RNA polymerase and a promoter

e) helicase and primase

Questions 7 and 8. You are studying two species of closelyrelated snakes, one species lives in sandy desert area and has paletan skin and the species lives in a volcanic rock area and has darkbrown skin. You a sequence the DNA from each type of snake anddiscover a gene encoding a protein that transports pigment into theskin cells. The pigment transporter protein is responsible for skincolor. When you analyze the DNA coding sequence of the pigmenttransporter from each snake you find these two DNA sequences (hashmarks have been added to indicate the reading frame):

pale tan snake: GCG/TTG/GAC/TGC/ACC (DNA template strand)CGC/AAC/CTG/ACG/TGG (complementary strand) dark brown snake:ACG/TTG/GAC/TGC/ACC (DNA template strand) TGC/AAC/CTG/ACG/TGG(complementary strand)

7. From these sequences you conclude:

a) that the amino acid sequence of the pigment transporters forthe two proteins are almost identical

b) that the amino acid sequence of the pigment transporters forthe two proteins are very dissimilar

c) that the amino acid sequence of the pigment transporters forthe two proteins are identical

8. Since the skin color is different in each snake, you concludefrom the sequence data above that:

a) the genetic code in the skin cells in each of these snakes isdifferent

b) the DNA sequence encoding the entire gene for pigmenttransporters in these two snakes is different

c) that one of the codons in the gene for the pigmenttransporter in these two snakes is different

9. You are analyzing eukaryotic cells that have been exposed tothe radioactive uracil. In most cells the radioactive uracil isinitially localized in the nucleus and then moves from the nucleusto the cytoplasm. However, you observe that in some cells theradioactive molecules stay in the nucleus and never arrive in thecytoplasm. This is most likely a defect in:

a) the transcription of the DNA

b) the processing of the mRNA

c) the translation of the RNA

d) the labeling of the RNA

e) the replication of the DNA

10. Which of the following is true of both eukaryotic andbacterial transcription? (select all that are true)
a) Transcription factors must bind the promoter before RNApolymerase initiates transcription

b) Messenger RNAs must be spliced before translation begins inorder to produce the appropriate gene product

c) During transcription only one DNA strand is used as atemplate to make the messenger RNA

d) Termination of transcription occurs when the RNA polymerasetranscribes a hairpin structure in the RNA followed by a string ofU

erinporpoise384

Question 4

Using the terms provided, complete the statements below. Some terms may apply more than once, while others may not apply at all. (15 points)

Guanine

histone

Double helix

Adenine

conservative

cytosine

Okazaki fragments

Thymine

introns

Leading strand

RNA polymerase

5-prime to 3-prime

Uracil

chromatin

DNA ligase

Semi-conservative

promoter

Lagging strand

DNA polymerase

nucleosomes

Electron transport chain

enhancer

Watson and Crick determined that DNA exists in the form of a _______________, where two antiparallel chains of nucleotides wind around each other. The nitrogenous bases project to the interior where they hydrogen bond in specific pairs, ___________ with __________ and _____________ with ____________.Meselson and Stahl demonstrated that DNA is replicated by the _______________ model in which the parent molecule unwinds and each strand serves as a template for synthesis of a new strand. Synthesis of DNA is carried out by _________________, which builds the new strands in the ___________ direction. While the ______________ grows continuously; the _______________ is built in short sections called _________________, which will eventually be joined together by __________________. Eukaryotic __________________ is composed of DNA and _____________ proteins that bind together forming ________________________, the basic units of DNA packaging.

Question 5

In the table below, predict (yes or no) whether or not the E. coli lac operon will be transcriptionally active in the presence or absence of glucose or lactose as indicated and respond to questions "a" and "b."

Lactose	Glucose	Lac expression?
No	Yes
Yes	Yes
Yes	No

Explain each of your answers in terms of the molecular mechanisms that are known to underlie the regulation of the lac operon. Which mechanism is considered to be negative control and which is considered to be positive control? Explain.

Question 6

Use the genetic code table in your textbook to aid you in answering the questions below. (15 points)

a.) Use the genetic code table to deduce the amino acid sequence of a protein encoded by the mRNA shown here:

5âAUGAUUGGAGGUUUGAUCGGGCAAUAGGGGUUUCAGUAAAUG3â

b.) Explain how the above sequence in "a" illustrates that redundancy of the genetic code.

c.) Explain what would happen if a mutational event caused the underlined "G" to be changed to a "U"? What is the name for this kind of mutation?

plumgoat220

BIOL150 Lecture 5: biol 150 Lecture 5: biol 130 Lecture 5: Unit 5 - Gene Expression

Document Summary

Get access

Related Documents

BIOL 212 Lecture Notes - Lecture 10: Small Interfering Rna, Messenger Rna, Rna Splicing

BIOL130 Lecture 5: Gene Expression

BIOL130 Chapter Notes - Chapter 7: Sigma Factor, Ribonucleotide, Dna Replication

Related Questions