You have discovered that the RNA transcribed from Gene X in maize is required for the regulation of Gene Y. The RNA of Gene X is not translated into proteins. However, in its absence, the levels of protein Y (product of Gene Y) are significantly increased. Propose one likely mechanism for how Gene X may be controlling the levels of Protein Y.

answer

watching

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Patrina SchowalterLv2

22 Jul 2018

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

Related questions

You have discovered a new gene âXâ that appears to be regulated by 3 transcription factors (E2F, SP-1 and C/EBPa). Another gene âYâ appears to also be regulated by these same proteins. Both genes are involved in cell cycle initiation but gene Y is expressed later in the cell cycle than gene X.

The DNA sequence at the promoter region is GCGCCAATGTGCTGACAGTTAATTAGGGCTA

The known DNA consensus sequence for each Transcription Factor is:

E2F â GCCAATGTGCTGA

SP-1 â GCTGACAGTTAA

C/EBPa â ACAGTTAATTAGG

It is not known which protein(s) are binding to their respective DNA consensus sequences. It is possible for one protein to be interacting with one another and not directly to the DNA. It is also possible for a transcription factor to use all or only a majority of the DNA consensus sequence. Both scenarios are possible. Discuss in general how protein:DNA and potein:protein interactions occur at the molecular level. Propose an explanation for what you believe may be happening and then design a series of experiments that will investigate the regulation of Gene X and Gene Y. All proteins and gene sequences are known. You have a large well-funded lab.

You are studying a gene (Gene X) in Escherichia coli that is expressed at 45 ÂºC but not at 37 ÂºC. You have shown that the regulation of this gene occurs at the level of transcription. In addition, you have isolated a regulatory protein required for induction of transcription of gene X at 45 ÂºC and have demonstrated that the proteins binds to a specific 8-nucleotide sequence upstream (i.e. at the 5' flanking region) of the structural gene. You have cloned the complete gene X containing the upstream regulatory sequence in a plasmid, and you have available an E.coli mutant clone in which the entire gene X has been deleted. You now want to determine which of the nucleotide(s) in the 8-nucleotide sequence (a protein binding site) of gene X are involved in the interaction with the binding protein. How could you determine this experimentally?

copperant963

The ara operon (or L-arabinose operon) iscontrolled by a regulator protein encoded by the araC regulatorygene region. This araC regulatory gene synthesizes a regulatoryprotein that is able to exert both a positve and negative controlon the expression of the structural genes of the ara operon. For mydiscussion in class, I need to propose a mechanism or model toeffectively control the expression of the araC gene (and its reg.protein). I am a little hung up on this because the araC gene isalready a regulatory gene. Is it possible that there are additionalregulatory gene/proteins that could upregulate the already presentregulator gene (upstream)? I was also wondering if there is afeedback mechanism involved with regulatory gene/products(proteins) that could play a role in controlling its expression(i.e. positive/ negative feedback inhibition)? If you have anyideas or proposals on how to control the expression of this araCgene (or any regulatory gene for the matter) it would be very muchappreciated! Thank you.