answers

watching

views

10 Jan 2018

Your patient is suffering from a bacterial infectin in the lungs and they are not responding to antibiotics. Medically speaking why would it be important to know the type of cell wall that the pathogen has?

answers

watching

153

views

For unlimited access to Homework Help, a Homework+ subscription is required.

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

iloveyou2023Lv10

24 Nov 2023

Unlock all answers

Get 1 free homework help answer.

Already have an account? Log in

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

teacherrecoLv10

23 Jul 2023

Already have an account? Log in

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

OC4396189Lv10

19 Oct 2022

Already have an account? Log in

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

eyuLv10

16 Oct 2022

Already have an account? Log in

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

yoru5Lv10

17 May 2022

Already have an account? Log in

You have 0 free answers left.
Get unlimited access to 3.8 million step-by-step answers.

Get unlimited access

Already have an account? Log in

Nelly StrackeLv2

12 Jan 2018

Already have an account? Log in

Related questions

1. Which of the following is true of mutations?

A. They always cause a change to an organisms phenotype.

B. They always cause a change to an organisms genotype

C. They are always fixed by DNA repair enzymes

D. They are always harmful for the organism

2. Which of the following is currently an important medical application of recombinant DNA technology?

A. DNA hybridization analysis to determine the presence of a microbial pathogen

B. Ribotyping of bacterial pathogens if interest to the medical field

C. Production of medically useful proteins in microbes

D. Production of humans with altered genotypes that render them resistant to pathogens

3. Why are bacterial plaids problematic for human health?

A. They are circular

B. They can be manuipulated in labs

C. They can transfer across species

D. They can integrate into the human nuclear genome

coffeeclam261

Answer questions 1-4 Using this website https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome

by copying the following Gene Sequences :

BacteriumA_GeneA1a

AACGAAATAATTTATATGTGACAGGATTTGTTAACAGGACAAATAATGTTTTT

TATCGCTTTGCTGATTT

TTCACATGTTACCTTTCCAGGTACAACAGCGGTTACATTGTCTGGTGACAGTA

GCTATACCACGTTACAG

CGTGTTGCAGGGATCAGTCGTACGGGGATGCAGATAAATCGCCATTCGTTGAC

TACTTCTTATCTGGATT

TAATGTCGCATAGTGGAACCTCACTGACGCAGTCTGTGGCAAGAGCGATGTTA

CGGTTTGTTACTGTGAC

AGCTGAAGCTTTACGTTTTCGGCAAATACAGAGGGGATTTCGTACAACACTGG

ATGATCTCAGTGGGCGT

TCTTATGTAATGACTGCTGAAGATGTTGATCTTACATTGAACTGGGGAAGGTT

GAGTAGTGTCCTGCCTG

>BacteriumB_GeneB1

TTAAATGATTTAGAAAAAAAATATAATGCTCATATTGGTGTTTATGCTTTAGA

TACTAAAAGT

GGTAAGGAAGTAAAATTTAATTCAGATAAGAGATTTGCCTATGCTTCAACTTC

AAAAGCGATAAATAGTG

CTATTTTGTTAGAACAAGTACCTTATAATAAGTTAAATAAAAAAGTACATATT

AACAAAGATGATATAGT

TGCTTATTCTCCTATTTTAGAAAAATATGTAGGAAAAGATATCACTTTAAAAG

CACTTATTGAGGCTTCA

ATGACATATAGTGATAATACAGCAAACAATAAAATTATAAAAGAAATCGGTGG

AATCAAAAAAGTTAAAC

AACGTCTAAAAGAACTAGGAGATAAAGTAACAAATCCAGTTAGATATGAGATA

GAATTAAATTACTATTC

ACCAAAGAGCAAAAAAGATACTTCAACACCTGCTGCCTTCGGTAAGACCCTTA

ATAAACTTATCGCCAAT

Q1. What is the function of the protein encoded by Bacterium A GeneA1

a) Shiga Toxin

b) Resistance to beta lactam antibiotics

c) Synthesis of peptidoglycan

d) Catalase enzyme

e) Oxidase enzyme

Q2.Why would the knowledge of the presence of GeneA1 in Bacterium A be important to medical staff if this organism was isolated from a hospital patient suffering with acute diarrhea?

a) The medical staff would know not to treat the infection with hydrogen peroxide

b) The medical staff would know they needed to treat the infection with hydrogen peroxide

c) The medical staff would suspect the symptoms were caused by a Gram positive bacterium and could choose an appropriate antibiotic for treatment

d) The medical staff would suspect the symptoms were caused by a toxin-producing bacterium and could choose an appropriate antibiotic for treatment

e) The medical staff would know they could not use beta-lactam antibiotics for treatment

Q3.What is the function of the protein encoded by Bacterium B GeneB1

a) Shiga Toxin

b) Resistance to beta lactam antibiotics

c) Synthesis of peptidoglycan

d) Catalase enzyme

e) Oxidase enzyme

Q4. Why would the knowledge of the presence of GeneB1 in Bacterium B be important to medical staff if this organism was isolated from a hospital patient suffering with septicaemia?

a) The medical staff would know not to treat the infection with hydrogen peroxide

b) The medical staff would know they needed to treat the infection with hydrogen peroxide

c) The medical staff would suspect the symptoms were caused by a Gram negative bacterium and could choose an appropriate antibiotic for treatment

d) The medical staff would suspect the symptoms were caused by a toxin-producing bacterium and could choose a beta-lactam antibiotic for treatment

e) The medical staff would know they could not use beta-lactam antibiotics for treatment

A patient came into the office suffering from flu like symptoms, accompanied by Fever, Abdominal pain, Back pain, Chills, Excessive sweating, Fatigue with joints pain. The fever has been an up and down fever. The patient said he had visited a farm a week ago and had drunk milk. He did not know if the milk or the yoghurt he had caused this.

1. Name another agent that also causes infection but in pasteurized dairy products? What are the virulence factors for this pathogen? How would you treat it based on that?

2. The patient does not have diarrhea, however how would the type of diarrhea assist in the identification of diseases. Give at least 3 examples stating the agent its disease, type of diarrhea, virulence factors and treatment.