Study Guides (248,575)
Canada (121,620)
York University (10,209)
Economics (643)
ECON 1540 (43)
Midterm

test2-2011.pdf

5 Pages
113 Views
Unlock Document

Department
Economics
Course
ECON 1540
Professor
Eytan Lasry
Semester
Winter

Description
NAME:__________ANSWERS____________________ STUDENT #:_______________________ 1 FACULTY OF SCIENCE & ENGINEERING SC/BIOL 3155 3.0 - VIROLOGY MIDTERM TEST #2 (W11) March 1, 201188 INSTRUCTIONS: (1) Fill in your NAME and STUDENT # on ALL 5 pages of this Test booklet & the Scantron Sheet. (2) Multiple choice questions have only ONE (1) CORRECT answer. Fill in answer on the Scantron Sheetupplied – only the scantron sheet will be marked. (3) The test is divided into 3 Sections. Section I Multiple choice 10 marks (1 mark per question) Section II Written answers 15 marks Total marks: 25 Section III Bonus question 1 mark (4) Answer ALL questions. (5) No calculators are permitted. (6) Total time: 80 mins (7) Hand in your Entire Test Booklet and Scantron Sheet - missing page(s) or exams not handed in will receive ZERO. GOOD LUCK! NAME:__________ANSWERS____________________ STUDENT #:_______________________ 2 SECTION I: Answer all questions 1 - 10 in this section on the SCANTRON SHEET (1) What is/are the function of EF-Ts in Q-beta phage replication? A. unknown B. unwinding the RNA C. binding to GTP D. binding to the UP sequence E. binding to CP F. two of the answers in A through E are correct G. all of the answers in A through E are correct (2) For phage lambda, which of the following statements is false? A. the viral genome inside the virion is linear DNA B. a bacterium with an integrated phage genome is called a prophage (false - is called a lysogen) C. the J proteins binds to LamB D. the virus particle structure is both icosahedral and helical E. viral mRNA transcription & viral DNA replication are performed, respectively,by host DdRp & host DdDp F. Rz is involved in cell lysis G. none of the above are correct answers to the question (3) Which of the following about papillomavirus is not a correct match? (matches are separated by "") A. LCR  ORI and transcriptional regulation B. poly(A) signals  early and late C. high levels of E1 and E2  vegetative replication D. plasmid DNA replication  50-100 copies E. alternative splicing early gene expression F. gardasil  therapeutic G. all of the above are correct matches (4) Which of the following proteins is/are an activator of HSV -genes? A. UL41 B. ICP4 C. HCF-1 D. ICP8 E. genome replication F. VP-16 G. two of the above are correct answers to the question (5) Considering the three different models for HSV envelopment and egress, which of the following statements is/are correct? A. in two of the models the NC leaves the nucleus by the nuclear pore B . none of the models have a secretory vesicle containing the enveloped particle fusing with the cell membrane C. in two of the models the envelope in obtained from the golgi D. in two of the models the enveloped particle fuses with the nuclear membrane E. in one model the enveloped particle exits the nucleus through the nuclear pore F. none of the models involve the NC budding into the golgi G. two of the above are correct answers to the question NAME:__________ANSWERS____________________ STUDENT #:_______________________ 3 (6) Which of the following statements about flavivirus E protein is/are false? A. is anchored to the membrane by its C-terminus B. is the major envelope glycoprotein C. is responsible for receptor binding D. is responsible for fusion with the cell membrane (false – fusion with the endosomal membrane) E. can form a head-to-tail dimer F. can form a trimer G. is a type-I transmembrane protein H. none of the above is the correct answer to the question (7) For phage lambda, which of the following statements is/are false? A. N causes anti-termination of mRNA transcribed fromLP B. N binds to the Cro mRNA C. N is necessary for Cro expression D. N is translated from an mRNA transcribed by the bacterial DdRp E. Cro binds to O 3 more tightly than to O 1 F. Croinhibits cI mRNA R G. cIcan activate or repress transcription H. two of the above are correct answers to the quest(Hn– is also acceptable for both B & C being false) (8) Which virus uses three different types of coding strategy for gene expression? A. togavirus B. flavivirus C. orthomyxovirus D. coronavirus E. gammaretrovirus F. pestivirus G. hepacivirus H. two the above are the right answer to the question (9) Which of the following mRNA sequences is predicted to be translated into a peptide of 7 amino acids leastefficiently? (the start codon in underlined) A. 5’-AGGUAGAUGGUCCUUCAACUUGCCUGCUGACUAGCUAGCUAGCUACGUA B. 5’-AGGCAGAUG AUCCUUCAACUUGCCUGAAGAUAGCUAGCUAGCUACGUAC C. 5’-AGGGAGAUG GUCCUUCAACUUGCCUGCUACUAGCUAGCUAGCUACGUAC D. 5’-AGGGAGAUG AUCCUUCAACUUGCCU
More Less

Related notes for ECON 1540

Log In


OR

Join OneClass

Access over 10 million pages of study
documents for 1.3 million courses.

Sign up

Join to view


OR

By registering, I agree to the Terms and Privacy Policies
Already have an account?
Just a few more details

So we can recommend you notes for your school.

Reset Password

Please enter below the email address you registered with and we will send you a link to reset your password.

Add your courses

Get notes from the top students in your class.


Submit