BIOL 1000 Chapter Notes - Chapter 4: Nonsense Mutation, Silent Mutation, Genetic Code

65 views4 pages

coralpanda308

4 Jan 2018

School

Department

Course

Professor

For unlimited access to Textbook Notes, a Class+ subscription is required.

Document Summary

Determine type of mutation + predict impact on protein: base-pair substitution. This may or may not lead to significant changes in protein structure and function. The frameshift causes immediate nonsense (a different codon will code for a different amino acid) but also changes the whole sequence following this specific amino acid because the triplet code changed: base removed. The exact same phenomenon occurs when a base is removed. Inversion: a broken segment is reattached to a chromosome in reverse orientation: meiosis, meiosis produces gametes with half the total number of chromosomes (23 instead of 46, meiosis produces genetically different daughter cells. Sexual reproduction produces unique offspring by union of male and female gametes (sperm + egg) After the first meiotic division, two cells are haploid (homologous chromosomes separated) Locus = location of the gene on a chromosome. Alleles are different versions of the same gene.

Related Questions

Part B

Think about the DNA coding sequence of a gene. If an A were swapped for a T, what kind of mutation could it cause and why?

a) It could cause a frameshift nonsense or frameshift missense mutation because it would change the reading frame of the codon triplet.

b) It could cause a silent, missense, or nonsense mutation because those are the types that can be caused by a nucleotide-pair substitution like this one.

c) It could cause a nonsense mutation because the sequence would no longer be the same, so the protein would be shorter and non-functional.

d) It could cause a silent mutation because A and T are complementary to each other so it is not really a substitution mutation.

Part C

Why is a frameshift missense mutation more likely to have a severe effect on phenotype than a nucleotide-pair substitution missense mutation in the same protein?

a) A substitution missense mutation causes the protein to be shorter and thus non-functional.

b) A frameshift missense will cause the codons to be out of order, but a substitution missense does not change the order of the codons.

c) A frameshift missense mutation will cause an early Stop codon, but a substitution missense might be silent.

d) A substitution missense affects only one codon, but a frameshift missense affects all codons downstream of the frameshift.

Part D

Which of the following sequences shows a frameshift mutation compared to the wild-type mRNA sequence?

a) wild-type	5â-AUGCAUACAUUGGAGUGA-3â
mutant	5â-AUGCAUACAGAGUGA-3â

b) wild-type	5â-AUGCAUACAUUGGAGUGA-3â
mutant	5â-AUGCAUACGUUGGAGUGA-3â

c) wild-type	5â-AUGCAUACAUUGGAGUGA-3â
mutant	5â-AUGCAUACAUCUGGAGUGA-3â

d) wild-type	5â-AUGCAUACAUUGGAGUGA-3â
mutant	5â-AUGCAUGUGACAUUGGAGUGA-3â

Part F

Suppose that the triplet of nucleotides indicated in bold (AGC) spans two codons, that is, CTA and GCC. If the triplet AGC were deleted from this DNA coding sequence, what effect would it have on the resulting protein?

5â-ATGCTAGCCTATCGTAAC-3â

a) The two flanking codons would be altered, but the rest of the amino acid sequence would be the same because there would be no frameshift.

b) The entire amino acid sequence would be altered due to the frameshift.

c) All of the amino acids after the deletion would be altered due to the frameshift.

d) All of the amino acids up to the deletion would be altered due to the frameshift.

mauvetrout554

Unit 2: Genetics Assignment

In this assignment you will convert a DNA sequence into proteins through several steps. If you have no idea where to begin I recommend that you watch the âHow to read the Genetic Codeâ and âProtein Synthesisâ videos

Here is the DNA sequence:

TACCACGCCAAGCGAAGCGGGATT

Part 1: Transcribe the sequence into mRNA and separate the mRNA into codons. Name the enzyme responsible and the start and stop codons used.

Part 2: Give the tRNA anticodons that match the mRNA.

Part 3: Translate the mRNA into amino acids.

Part 4: Give an example of how a mutation to this sequence could cause a silent mutation.

Hereâs an example that you can complete:

Normal DNA = CAC Mutated DNA = CAG

Normal mRNA = Mutated mRNA=

Normal amino acid = Mutated amino acid=

*What do you notice happened above?

*What does this tell you about the effect of a silent mutation?

Part 5: Give an example of how a mutation to this sequence could cause a missense mutation.

Hereâs an example that you can complete:

Normal DNA = CAC Mutated DNA = GAC

Normal mRNA = Mutated mRNA=

Normal amino acid = Mutated amino acid=

*What do you notice happened above?

*What does this tell you about the effect of a missense mutation?

Part 6: Besides mutations how else do bacteria acquire new genes? Define each of these in your own words:

*transformation

*transduction

*conjugation

salmonrabbit236

DNA and Genes Lab Activity
Complete your answers in the spaces provided. USE YOUR OWN WORDS â Yes even
for definitions! Remember to add your last name and first initial to the file name prior to
saving and submitting your completed assignment through Canvas.
Use your textbook, notes and these websites to answer the pre lab questions.
http://learn.genetics.utah.edu/content/molecules/transcribe/
http://www.vcbio.science.ru.nl/en/virtuallessons/cellcycle/trans/
Pre Lab Questions:
1. What is the product of transcription?
2. What is the region of DNA called where transcription begins?
3. What is the product of translation?
4. In your own words define each of the following:
Silent mutation
Missense mutation
Nonsense mutation
Frame shift mutation
5. Where in the cell does translation take place?
Click on the link below to access the online lab.
http://www.mhhe.com/biosci/genbio/virtual_labs_2K8/pages/DNA_And_Genes.html
Download and print the instructions for reference as you work through the lab. As you work through the lab fill in the table below. Use this information to answer the questions that follow contained in this document.
First read through the mutation guide. Once you close the guide you will see the buttons to begin the simulation. Note, you will be translating the mRNA strand into a protein. As you work through each of the mutations fill in the charts below. You must complete 4 mutations for this lab activity. Itâs good practice working with the codon table .
â Aris labs calls the codon table the âGenetic Code Chartâ. Use the amino acid abbreviation for the protein sequence. For example the amino acid proline is abbreviated as pro.
You have to fill in all the letters AND the resulting amino acid sequence by dragging and dropping before you click the [check] button. Abrieviate STOP as either STP or END.
For each of the three mutations you will complete, fill in the table in this lab document with the original mRNA and amino acid sequence and the mRNA sequence and the resulting amino acid sequence RESULTING FROM the mutation as outlined in the mutation rule.
The various mutations represent missense, nonsense, silent and frame shift mutations. You must complete one of each. The lab will not necessarily present the mutations in this order. You must do the mutation and identify which type it is and make sure you do one of each.
6. Frame Shift Mutation example:
Provide the mutation rule you are following.
Original A. Acids
Original mRNA
Mutated mRNA
Mutated A. Acids
7. Missense Mutation example:
Provide the mutation rule you are following.
Original A. Acids
Original mRNA
Mutated mRNA
Mutated A. Acids
8. Nonsense Mutation example:
Provide the mutation rule you are following.
Original A. Acids
Original mRNA
Mutated mRNA
Mutated A. Acids
9. Silent Mutation example:
Provide the mutation rule you are following.
Original A. Acids
Original mRNA
Mutated mRNA
Mutated A. Acids
Post Lab Questions
10. From the mutations you have explored, which one is the least severe. Explain your answer.
11. From the mutations you have explored, which one is the most severe. Why?
12. Aside from silent mutations which have no effect on amino acid sequence, are all mutations bad? Explain your answer.

champagnerat497

BIOL 1000 Chapter Notes - Chapter 4: Nonsense Mutation, Silent Mutation, Genetic Code

Document Summary

Get access

Related Documents

BIOL 1000 Chapter Notes - Chapter 14: Mutation, Base Pair, Peptide

BIOL 1000 Study Guide - Final Guide: Cytosol, Mendelian Inheritance, Genetic Linkage

BIOL 1000 Lecture Notes - Lecture 26: Start Codon, Rna Interference, Transfer Rna

Related Questions