Biochemistry 2288A Lecture : DNA Fingerprinting

78 views2 pages

orchidotter238

1 Jan 2012

School

Department

Course

Professor

For unlimited access to Class Notes, a Class+ subscription is required.

Document Summary

There are sequences in genome called vntr which are repeat sequences i. e. cacaca where that repeat varies form 4-40 times depending on alleles. We have hundreds of thousands of these repeat sequences. They are variable from allele to allele in population. Repeat sequences found throughout genome many times in diff places. We don t know what they do but they re there. Number of repeats differ, so length of fragment differs. In many regions of our genome there are repetitive sequences (cacacaca ). The repeat varies from 4~-40 times depeding on the allele. The repeat sequences are called vntrs for vaandem repeats (or strs fro short tandem repeats). Number of repeats differs there fore length of fragment differs. If pcr reactions is performed using genomic dna from one person and a pair of primers flanking one vntr locus, two bands will usually be seen after gel electrophoresis. a)true: false.

Related Questions

During acquisition of a new spacer the repeat must be replicated. From which repeat sequence in the CRISPR DNA, is the repeat replicated? How might this be significant to the integrity of the CRISPR defense system?

4. Microsatellites are repeating sequences of 2-6 base pairs ofDNA. KAH is a hypothetical human microsatellite locus with arepeating sequence of CAGA. The locus is shown in the figure with20 bp of flanking DNA sequences that can serve as primers foramplification of the locus by PCR.

5â GTTACTTAGGTATTGCCGAT KAH ATCTTGTAACCTAT ACTGTG3â

3â CAATGAATCCATAACGGCTA LOCUSTAGAACATTGGATATGACAC 5â

a. You will use PCR to genotype individuals for the KAH locus.The primers should be 20 nucleotides long. Determine the sequencesfor the two primers required to amplify the KAH locus. Note thatyou must label the 5â and 3â ends of both primers. Also, primersequences, by designation, are always written in the 5â to 3âdirection. 1 pt

b. Assume two KAH alleles, one with 8 and another with 5 copiesof the repeating unit. Using the primers you have designed, whatwill be the sizes of the amplified PCR products for each allele? 1pt

c. There are actually four known alleles of the KAH locus with13, 10, 8, and 5 copies of the repeating unit. How many possiblegenotypes are there for these alleles, and what are they? 1 pt

d. One parent is heterozygous for the 13 and 8 alleles of theKAH locus and the other parent is heterozygous for the 8 and 5alleles. The two parents live with three children. When youdetermine the genotype of the two children, the two genotypes are(8, 5) and (13, 10). What can you conclude about the parentage ofthe two children? 1 pt

amaranthsquirrel102

Huntington's disease is an inherited neurological ailment with a variable age of onset. A protein called huntingtin has a sequence of repeated glutamine residues, all encoded by CAG. The number of repeated CAG triplets is expanded in Huntington's disease, apparently as the result of replication errors. The age of onset is related to the number of CAG triplets in the repeat region; the more glutamine codons, the earlier the onset. Describe experimental evidence, using Southern blotting, that is consistent with this finding.

From the human genome sequence, select _____________ enzymes that will bracket the region of the huntingtin gene that contains the triplet repeat. Obtain DNA from members of families afflicted with Huntington's disease. Carry out Southern blotting with the selected____________ enzymes. Probe each blot with an oligonucleotide (____________ )n or its complement ____________( )n. Or PCR amplify the region of interest and run gel electrophoresis to estimate, from the size of the repeat fragment, the number of repeats; this is what is actually done in HD testing. The age of onset should correlate______________ with the size of the gel band detected by the probe; the larger the band, the ___________ the age of onset.

(Word bank below)

GTC

positively

CAG

restriction

ligation

younger

negatively

older

purplejellyfish572

Biochemistry 2288A Lecture : DNA Fingerprinting

Document Summary

Get access

Related Documents

BIOL 142 Lecture Notes - Lecture 20: Dna Microarray, Dna Profiling, Tandem Repeat

MCB 2400 Study Guide - Final Guide: Robertsonian Translocation, Lethal Allele, Down Syndrome

BIOL 142 Lecture Notes - Lecture 26: Exon, Chromosome, Reverse Transcriptase

Related Questions